Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • ffinkernagel
    Senior Member
    • Oct 2009
    • 110

    #16
    yeah, that's what the line with grep is supposed to check-whether that string abyss complains about is in there.

    Comment

    • Seta
      Member
      • Mar 2011
      • 14

      #17
      how long should that take..hours or just minutes...mine is already bussy for an hour...

      Comment

      • ffinkernagel
        Senior Member
        • Oct 2009
        • 110

        #18
        Well, for a 1.2 gig file (compressed), my machine needed about 3 minutes (transfering it on a gigabit network) for doing the 'gzip -cd | grep' stanca.

        Comment

        • Seta
          Member
          • Mar 2011
          • 14

          #19
          I don't get any output at all, if I use the line:
          gzip -cd s_7_sequence.fastq.gz | grep "Ms_7_sequence.txt"
          But I also already thought that there wouldn't be a line with "Ms_7_sequence.txt"....

          Comment

          • ffinkernagel
            Senior Member
            • Oct 2009
            • 110

            #20
            Yes, no output is what you would get if there was no 'Ms_7_sequence.txt' in there.

            Curiouser and curiouser - have you tried passing the un-gziped file (gzip -d name.fastq.gz) to AbySS?

            Comment

            • Seta
              Member
              • Mar 2011
              • 14

              #21
              That is weird!!! the last time I tried it din't work and now it is reading the file! I'll cross my fingers and hope for the best. Do you have any idea how long it could take? I read somewhere that it can take between 3 and 10 hours...

              Comment

              • ffinkernagel
                Senior Member
                • Oct 2009
                • 110

                #22
                that depends.
                What exactly are you trying to assemble, how many reads do you have, etc?.

                Generally, assembly can take a long (long) time.

                Comment

                • Dorisday81
                  Junior Member
                  • Jun 2011
                  • 1

                  #23
                  Hi all, I'm new here and have a problem.
                  Maybe its not right place to write but I can not write new post.

                  I'm using the ABySS for 36bp sequences and now will use the trans-ABySS.

                  I used command: for k in {18..35}; do ABYSS <file to analyze> -o <where save the file>-k@$k.fa;

                  My input was file with contigs (after format: fastanrdb) with FASTA extenstion.

                  I got from ABYSS analysis files. They looks like (examples):

                  >0 31 117
                  AGACTTCCCAACATTTATTGCTCTTTCTCTT
                  >1 35 79
                  ATGAATTCTATTGGAGATTGTACATTAGTTATGTA
                  >2 27 60
                  ATGAATTCTATTGGAGAATGTACATTA
                  >3 44 666
                  TTTTTATTTTTGTTCAGAAGGAGTCGTTGGTTGTTCTTCATTTT
                  >4 111 1332
                  GATGGTGTAATGAACTCAACAATATCATCTCTTATTACTATATCTGACCGTGCTTATGTAACATTAACTAATTACCAAGGATTGTATAGATTAAATTGTGACCAGAAAACT
                  >5 18 31
                  GGAGTGTCGATGCTTGAA
                  >6 38 213
                  GCAAATTCTGTTACAATTGATATTTCTCCTTCTGTATA


                  I have problem with next step of analysis-the trans-Abyss

                  In manual guide I read that the trans abyss needs specific folder structure.

                  I dont know what does it means, because I put my results from abyss (in fasta) in folders: LIB0001/kn(15-35)/...fasta (from abyss)

                  I dont know what is next?

                  sorry for so complicates question but I am so sad sitting, reading and nothing.....

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                    by SEQadmin2



                    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                    ...
                    07-09-2026, 11:10 AM
                  • SEQadmin2
                    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                    by SEQadmin2



                    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                    07-08-2026, 05:17 AM
                  • GATTACAT
                    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                    by GATTACAT
                    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                    07-01-2026, 11:43 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, 07-13-2026, 10:26 AM
                  0 responses
                  18 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-09-2026, 10:04 AM
                  0 responses
                  30 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-08-2026, 10:08 AM
                  0 responses
                  16 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-07-2026, 11:05 AM
                  0 responses
                  34 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...