[kmcarr]

Debabrata:

For current "Titanium" reagents the adapter sequences are:

A: CGTATCGCCTCCCTCGCGCCATCAG
B: CTATGCGCCTTGCCAGCCCGCTCAG


Simon

Simon,

Where did you get these? They do not the match the Lib-L Titanium adaptor sequences I have seen.

Phillip

These are the Amplicon primer sequences. If you use these sequences you would need to use the Lib-A emulsion kit

[naxin]

There is clearly a reagent problem with emPCR reagents of late. Even libraries that we have previously run do not perform well using recent lots of SV emPCR reagents. This is less true of LV emPCR but it has also been somewhat problem. I understand from our Roche rep that they are undertaking a "reformulation" of the SV kits right now and have already done so for the LV emPCR kits, that is supposed to reduce the inter-kit variability in success.

On another thread I have seen reports that the problem is even worse for Lib-A kits than Lib-L.

Do you mean the emPCR kit with the new emulsion Oil? I run two emPCR, and 3 out of 4 cups have problem.

[rmprieto]

We have been doing some Lib-A SV experiments recently, and we have a similar problem: in spite of increasing the amount of template, the enrichment percentage remains poor. Do you have any information regarding the kit numbers that are defective? Maybe we are facing the same problem than you have found.

[RCJK]

Has anyone had issues lately with broken emulsions, specifically with MV and/or LV? I've not had this issue until a few weeks ago. The lots of oil involved were MV: 93750020 & 93766120, LV: 93771120. The emulsions do not look completely broken, but many of the wells have a bead pellet at the bottom, with a clear layer, and then a white layer above that. I've repeated the same samples across two lots of MV oils and have had the same thing. The LV reactions were a different set of libraries (one Lib-A and one Lib-L) and also showed the same. Roche is being rather quiet about this and not offering any other suggestions to me other than possibly sending a new kit to try it again.

[gallus]

we've been having problems with SV lots (93768220 and 93776220). they look like the emPCR is the issue though no obvious broken reactors. the attached 1/8 Ti bacterial genomic was deemed "good" by the Roche engineer we talked to (though i disagree). we've sequenced the same type of sample/prep from this PI with lot 9378740 and beautiful distribution with avg of 500 bp. now, hardly any reads above 400 bp with a very odd peak at 120 bp. we've submitted RunReports etc to support with only the normal "we've received your message" response. any others have this lot (especially *8220)?

[Soulbee]

i'm using LV lot # 93799720 which has not given me any problems, and neither has the MV (but not sure what the Lot number is for the MV oil, sorry!)

[Christina85]

Hi!

Can you think of an explanation for very high enrichment values (40% to even 70%)?

I have posted the details on "Calculation of % Bead enrichment (454 FLX Titanium)": http://seqanswers.com/forums/showthread.php?t=18588

Thank you!!