Hi!
Can you think of an explanation for very high enrichment values (40% to even 70%)?
I have posted the details on "Calculation of % Bead enrichment (454 FLX Titanium)": http://seqanswers.com/forums/showthread.php?t=18588
Thank you!!
Announcement
Collapse
No announcement yet.
X
-
i'm using LV lot # 93799720 which has not given me any problems, and neither has the MV (but not sure what the Lot number is for the MV oil, sorry!)
Leave a comment:
-
we've been having problems with SV lots (93768220 and 93776220). they look like the emPCR is the issue though no obvious broken reactors. the attached 1/8 Ti bacterial genomic was deemed "good" by the Roche engineer we talked to (though i disagree). we've sequenced the same type of sample/prep from this PI with lot 9378740 and beautiful distribution with avg of 500 bp. now, hardly any reads above 400 bp with a very odd peak at 120 bp. we've submitted RunReports etc to support with only the normal "we've received your message" response. any others have this lot (especially *8220)?Attached Files
Leave a comment:
-
Has anyone had issues lately with broken emulsions, specifically with MV and/or LV? I've not had this issue until a few weeks ago. The lots of oil involved were MV: 93750020 & 93766120, LV: 93771120. The emulsions do not look completely broken, but many of the wells have a bead pellet at the bottom, with a clear layer, and then a white layer above that. I've repeated the same samples across two lots of MV oils and have had the same thing. The LV reactions were a different set of libraries (one Lib-A and one Lib-L) and also showed the same. Roche is being rather quiet about this and not offering any other suggestions to me other than possibly sending a new kit to try it again.
Leave a comment:
-
We have been doing some Lib-A SV experiments recently, and we have a similar problem: in spite of increasing the amount of template, the enrichment percentage remains poor. Do you have any information regarding the kit numbers that are defective? Maybe we are facing the same problem than you have found.
Leave a comment:
-
Originally posted by tplsmith View PostThere is clearly a reagent problem with emPCR reagents of late. Even libraries that we have previously run do not perform well using recent lots of SV emPCR reagents. This is less true of LV emPCR but it has also been somewhat problem. I understand from our Roche rep that they are undertaking a "reformulation" of the SV kits right now and have already done so for the LV emPCR kits, that is supposed to reduce the inter-kit variability in success.
On another thread I have seen reports that the problem is even worse for Lib-A kits than Lib-L.
Leave a comment:
-
Originally posted by proteasomeDebabrata:
For current "Titanium" reagents the adapter sequences are:
A: CGTATCGCCTCCCTCGCGCCATCAG
B: CTATGCGCCTTGCCAGCCCGCTCAG
Simon
Originally posted by pmiguel View PostSimon,
Where did you get these? They do not the match the Lib-L Titanium adaptor sequences I have seen.
Phillip
Leave a comment:
-
Originally posted by proteasome View PostDebabrata:
For current "Titanium" reagents the adapter sequences are:
A: CGTATCGCCTCCCTCGCGCCATCAG
B: CTATGCGCCTTGCCAGCCCGCTCAG
Simon
Where did you get these? They do not the match the Lib-L Titanium adaptor sequences I have seen.
Phillip
Leave a comment:
-
Hey do you guys know if the sequencing kits are in backorder right now and how long it may take to get them?
Also, during full processing of your sequencing data, its says "410 reads were capped" .. any idea what this means? Thank you!
Leave a comment:
-
There is clearly a reagent problem with emPCR reagents of late. Even libraries that we have previously run do not perform well using recent lots of SV emPCR reagents. This is less true of LV emPCR but it has also been somewhat problem. I understand from our Roche rep that they are undertaking a "reformulation" of the SV kits right now and have already done so for the LV emPCR kits, that is supposed to reduce the inter-kit variability in success.
On another thread I have seen reports that the problem is even worse for Lib-A kits than Lib-L.
Leave a comment:
-
thanks soulbee
well enrichment primers are from the kits and they are not outdated ..so far I have done everything according to the protocols..so I don't know what went wrong..I tried different kits as well...
Leave a comment:
-
no, my problem is usually the opposite where too little beads are being washed off even though very small amount of template beads were added in the first place. If they are all being washed off and you have done everything else properly upto this point, your enrichment primer may not have bound properly to your DNA which means they just cant bind to the enrichment beads. Check the status of your adaptors as wells as your enrichment primers... ?
Leave a comment:
-
Hi
I am having serious problem in beads recovery after emulsion PCR. It seems all the beads are getting washed off ....and I have left with no beads for sequencing..does anyone have similar problems?? please help..
Leave a comment:
Latest Articles
Collapse
-
by seqadmin
The recent pandemic caused worldwide health, economic, and social disruptions with its reverberations still felt today. A key takeaway from this event is the need for accurate and accessible tools for detecting and tracking infectious diseases. Timely identification is essential for early intervention, managing outbreaks, and preventing their spread. This article reviews several valuable tools employed in the detection and surveillance of infectious diseases.
...-
Channel: Articles
Yesterday, 01:15 PM -
-
by seqadmin
Microbiome research has led to the discovery of important connections to human and environmental health. Sequencing has become a core investigational tool in microbiome research, a subject that we covered during a recent webinar. Our expert speakers shared a number of advancements including improved experimental workflows, research involving transmission dynamics, and invaluable analysis resources. This article recaps their informative presentations, offering insights...-
Channel: Articles
11-09-2023, 07:02 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, Yesterday, 08:12 AM
|
0 responses
14 views
0 likes
|
Last Post
by seqadmin
Yesterday, 08:12 AM
|
||
Started by seqadmin, 11-22-2023, 09:29 AM
|
1 response
46 views
0 likes
|
Last Post
![]()
by VilliamPast
11-25-2023, 02:47 AM
|
||
Started by seqadmin, 11-22-2023, 08:53 AM
|
0 responses
30 views
0 likes
|
Last Post
by seqadmin
11-22-2023, 08:53 AM
|
||
Started by seqadmin, 11-21-2023, 08:24 AM
|
0 responses
23 views
0 likes
|
Last Post
by seqadmin
11-21-2023, 08:24 AM
|
Leave a comment: