454 titanium emulsion PCR problems?

[proteasome]

Debabrata:

For current "Titanium" reagents the adapter sequences are:

A: CGTATCGCCTCCCTCGCGCCATCAG
B: CTATGCGCCTTGCCAGCCCGCTCAG


Simon

[Debabrata.]

Hello,
I would like to know the exact sequence of Adaptor A and Adaptor B of Roche 454.

[Soulbee]

I ve been having a problem with emPCR as well with the enrichment step. I used the same reagents and one LV oil from the same kits to process two different samples. During the enrichment step, there has been a bit of a problem in washing away of the sequencing beads "6-10" times that are not bound to the enrichment beads.

one sample was enriched and processed fine during this stage, only requiring about 10 washes until no more white sequencing beads were being washed out. The second sample however kept releasing the unbound white beads even after 30-40 washes. The input of the library I put into emPCR was very low so I know this was probably not due to having too much template to start with. Anyone having this similar problem or can speculate as to why this may be? This has happened to a few of other samples as well.. thanks!

[boss_hoss]

we had a similar problem with specifically SVE setups, where we were seeing a ton of broken wells and poor enrichments. it turned out to not only be an oil lot problem, but an oil problem that spanned across two separate oil lots. it was really hard to diagnose. we ended up switching to the newest lot available and it solved the problem.

[Claudia Stewart]

emPCR problems

Yes, we have - we were told they are 'unseen broken reactors', meaning that even though these were inspected at emPCR completion and found to be non- biphasic (ie not obviously broken) that there can be broken reactors that are not visibly biphasic.
We have not seen this in FLX chemistry only Ti chemistry.
It is a major bummer.

[boss_hoss]

have you seen any broken emulsion wells? do your library traces look normal? what is your enrichment percentage specification range?

[kjones]

Has anyone else been experiencing problems with titanium emPCR? We have been having a lot of failed runs that can't be attributed to sequencing problems...the control fragments look fine. The emPCR seems to go fine...we get an enriched recovery within the normal range, but then the sequencing is an utter failure, apart from the control reads of course. This is happening across multiple library types (standard shotgun Titanium Paired End Titanium), and from samples of different types from different sources. We haven't changed our library prep approach recently, so we keep focusing on the emPCR as the potential problem. We have heard that Roche has started using a new vendor for their emPCR additive and are wondering if this is related, but can't get confirmation from Roche. Anyone else seeing this?