Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • kjones
    Junior Member
    • Apr 2009
    • 1

    454 titanium emulsion PCR problems?

    Has anyone else been experiencing problems with titanium emPCR? We have been having a lot of failed runs that can't be attributed to sequencing problems...the control fragments look fine. The emPCR seems to go fine...we get an enriched recovery within the normal range, but then the sequencing is an utter failure, apart from the control reads of course. This is happening across multiple library types (standard shotgun Titanium Paired End Titanium), and from samples of different types from different sources. We haven't changed our library prep approach recently, so we keep focusing on the emPCR as the potential problem. We have heard that Roche has started using a new vendor for their emPCR additive and are wondering if this is related, but can't get confirmation from Roche. Anyone else seeing this?
  • boss_hoss
    Junior Member
    • Jun 2009
    • 6

    #2
    have you seen any broken emulsion wells? do your library traces look normal? what is your enrichment percentage specification range?

    Comment

    • Claudia Stewart
      Junior Member
      • Sep 2008
      • 4

      #3
      emPCR problems

      Yes, we have - we were told they are 'unseen broken reactors', meaning that even though these were inspected at emPCR completion and found to be non- biphasic (ie not obviously broken) that there can be broken reactors that are not visibly biphasic.
      We have not seen this in FLX chemistry only Ti chemistry.
      It is a major bummer.

      Comment

      • boss_hoss
        Junior Member
        • Jun 2009
        • 6

        #4
        we had a similar problem with specifically SVE setups, where we were seeing a ton of broken wells and poor enrichments. it turned out to not only be an oil lot problem, but an oil problem that spanned across two separate oil lots. it was really hard to diagnose. we ended up switching to the newest lot available and it solved the problem.

        Comment

        • Soulbee
          Member
          • Jun 2010
          • 25

          #5
          I ve been having a problem with emPCR as well with the enrichment step. I used the same reagents and one LV oil from the same kits to process two different samples. During the enrichment step, there has been a bit of a problem in washing away of the sequencing beads "6-10" times that are not bound to the enrichment beads.

          one sample was enriched and processed fine during this stage, only requiring about 10 washes until no more white sequencing beads were being washed out. The second sample however kept releasing the unbound white beads even after 30-40 washes. The input of the library I put into emPCR was very low so I know this was probably not due to having too much template to start with. Anyone having this similar problem or can speculate as to why this may be? This has happened to a few of other samples as well.. thanks!

          Comment

          • Debabrata.
            Junior Member
            • Jul 2010
            • 2

            #6
            Hello,
            I would like to know the exact sequence of Adaptor A and Adaptor B of Roche 454.

            Comment

            • proteasome
              Member
              • Jul 2009
              • 22

              #7
              Debabrata:

              For current "Titanium" reagents the adapter sequences are:

              A: CGTATCGCCTCCCTCGCGCCATCAG
              B: CTATGCGCCTTGCCAGCCCGCTCAG


              Simon

              Comment

              • Debabrata.
                Junior Member
                • Jul 2010
                • 2

                #8
                Thanks

                Simon,

                Thank you so much.

                Debabrata.

                Comment

                • uhany
                  Junior Member
                  • Apr 2010
                  • 6

                  #9
                  Hi

                  I am having serious problem in beads recovery after emulsion PCR. It seems all the beads are getting washed off ....and I have left with no beads for sequencing..does anyone have similar problems?? please help..

                  Comment

                  • Soulbee
                    Member
                    • Jun 2010
                    • 25

                    #10
                    no, my problem is usually the opposite where too little beads are being washed off even though very small amount of template beads were added in the first place. If they are all being washed off and you have done everything else properly upto this point, your enrichment primer may not have bound properly to your DNA which means they just cant bind to the enrichment beads. Check the status of your adaptors as wells as your enrichment primers... ?

                    Comment

                    • uhany
                      Junior Member
                      • Apr 2010
                      • 6

                      #11
                      thanks soulbee

                      well enrichment primers are from the kits and they are not outdated ..so far I have done everything according to the protocols..so I don't know what went wrong..I tried different kits as well...

                      Comment

                      • tplsmith
                        Junior Member
                        • Aug 2008
                        • 7

                        #12
                        There is clearly a reagent problem with emPCR reagents of late. Even libraries that we have previously run do not perform well using recent lots of SV emPCR reagents. This is less true of LV emPCR but it has also been somewhat problem. I understand from our Roche rep that they are undertaking a "reformulation" of the SV kits right now and have already done so for the LV emPCR kits, that is supposed to reduce the inter-kit variability in success.

                        On another thread I have seen reports that the problem is even worse for Lib-A kits than Lib-L.

                        Comment

                        • uhany
                          Junior Member
                          • Apr 2010
                          • 6

                          #13
                          thanks a lot tplsmith..I was thinking the same as well..

                          Comment

                          • Soulbee
                            Member
                            • Jun 2010
                            • 25

                            #14
                            Hey do you guys know if the sequencing kits are in backorder right now and how long it may take to get them?

                            Also, during full processing of your sequencing data, its says "410 reads were capped" .. any idea what this means? Thank you!

                            Comment

                            • pmiguel
                              Senior Member
                              • Aug 2008
                              • 2328

                              #15
                              Originally posted by proteasome View Post
                              Debabrata:

                              For current "Titanium" reagents the adapter sequences are:

                              A: CGTATCGCCTCCCTCGCGCCATCAG
                              B: CTATGCGCCTTGCCAGCCCGCTCAG


                              Simon
                              Simon,

                              Where did you get these? They do not the match the Lib-L Titanium adaptor sequences I have seen.

                              Phillip

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                Yesterday, 11:10 AM
                              • SEQadmin2
                                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                by SEQadmin2



                                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                07-08-2026, 05:17 AM
                              • GATTACAT
                                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                by GATTACAT
                                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                07-01-2026, 11:43 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, Yesterday, 10:04 AM
                              0 responses
                              10 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-08-2026, 10:08 AM
                              0 responses
                              7 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-07-2026, 11:05 AM
                              0 responses
                              12 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-02-2026, 11:08 AM
                              0 responses
                              31 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...