Has anyone else been experiencing problems with titanium emPCR? We have been having a lot of failed runs that can't be attributed to sequencing problems...the control fragments look fine. The emPCR seems to go fine...we get an enriched recovery within the normal range, but then the sequencing is an utter failure, apart from the control reads of course. This is happening across multiple library types (standard shotgun Titanium Paired End Titanium), and from samples of different types from different sources. We haven't changed our library prep approach recently, so we keep focusing on the emPCR as the potential problem. We have heard that Roche has started using a new vendor for their emPCR additive and are wondering if this is related, but can't get confirmation from Roche. Anyone else seeing this?
-
-
have you seen any broken emulsion wells? do your library traces look normal? what is your enrichment percentage specification range? -
emPCR problems
Yes, we have - we were told they are 'unseen broken reactors', meaning that even though these were inspected at emPCR completion and found to be non- biphasic (ie not obviously broken) that there can be broken reactors that are not visibly biphasic.
We have not seen this in FLX chemistry only Ti chemistry.
It is a major bummer.Comment
-
we had a similar problem with specifically SVE setups, where we were seeing a ton of broken wells and poor enrichments. it turned out to not only be an oil lot problem, but an oil problem that spanned across two separate oil lots. it was really hard to diagnose. we ended up switching to the newest lot available and it solved the problem.Comment
-
I ve been having a problem with emPCR as well with the enrichment step. I used the same reagents and one LV oil from the same kits to process two different samples. During the enrichment step, there has been a bit of a problem in washing away of the sequencing beads "6-10" times that are not bound to the enrichment beads.
one sample was enriched and processed fine during this stage, only requiring about 10 washes until no more white sequencing beads were being washed out. The second sample however kept releasing the unbound white beads even after 30-40 washes. The input of the library I put into emPCR was very low so I know this was probably not due to having too much template to start with. Anyone having this similar problem or can speculate as to why this may be? This has happened to a few of other samples as well.. thanks!Comment
-
Hello,
I would like to know the exact sequence of Adaptor A and Adaptor B of Roche 454.Comment
-
Debabrata:
For current "Titanium" reagents the adapter sequences are:
A: CGTATCGCCTCCCTCGCGCCATCAG
B: CTATGCGCCTTGCCAGCCCGCTCAG
SimonComment
-
Thanks
Simon,
Thank you so much.
Debabrata.Comment
-
Hi
I am having serious problem in beads recovery after emulsion PCR. It seems all the beads are getting washed off ....and I have left with no beads for sequencing..does anyone have similar problems?? please help..Comment
-
no, my problem is usually the opposite where too little beads are being washed off even though very small amount of template beads were added in the first place. If they are all being washed off and you have done everything else properly upto this point, your enrichment primer may not have bound properly to your DNA which means they just cant bind to the enrichment beads. Check the status of your adaptors as wells as your enrichment primers... ?Comment
-
thanks soulbee
well enrichment primers are from the kits and they are not outdated ..so far I have done everything according to the protocols..so I don't know what went wrong..I tried different kits as well...
Comment
-
There is clearly a reagent problem with emPCR reagents of late. Even libraries that we have previously run do not perform well using recent lots of SV emPCR reagents. This is less true of LV emPCR but it has also been somewhat problem. I understand from our Roche rep that they are undertaking a "reformulation" of the SV kits right now and have already done so for the LV emPCR kits, that is supposed to reduce the inter-kit variability in success.
On another thread I have seen reports that the problem is even worse for Lib-A kits than Lib-L.Comment
-
thanks a lot tplsmith..I was thinking the same as well..Comment
-
Hey do you guys know if the sequencing kits are in backorder right now and how long it may take to get them?
Also, during full processing of your sequencing data, its says "410 reads were capped" .. any idea what this means? Thank you!Comment
-
Simon,Originally posted by proteasome View Post
Where did you get these? They do not the match the Lib-L Titanium adaptor sequences I have seen.
PhillipComment
-
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...07-31-2026, 11:01 AM -
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...07-20-2026, 11:48 AM
Comment