Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • ellli555
    replied
    RL adaptors

    Originally posted by tokikake View Post
    I don't know, if the sequence of the rapid adaptors is still of interest, but here is an official document from roche.

    Cheers!
    Hi tokikake,
    I could not open the attached file. Could you upload it again?
    Thanks!
    Elli

    Leave a comment:


  • orangekel13
    replied
    Thanks for posting that document, tokikake! I looked and looked and couldn't find that anywhere!

    Leave a comment:


  • tokikake
    replied
    I don't know, if the sequence of the rapid adaptors is still of interest, but here is an official document from roche.

    Cheers!
    Attached Files

    Leave a comment:


  • 0Gen
    replied
    Hi,

    The RL adaptor seems to be a Roche secret. There is a recent paper uses an Y adatpor + Taqman-MGB qPCR + Poisson distribution.

    ..................5'C*C*A*T*C*T*CATCCCTGCGTGTCTCCGA*C*T*C*A*G*T3'
    ..............................................||||| | | | | |
    3'G*G*A*T*A*G*GGGACACACGGAACAGATAGGGGACAACGCACAGGCT*G*A*G*T*Cp5'



    A single Y adaptor has adavantages over two adaptors (A and B), as it showed in Fig.1.

    http://nar.oxfordjournals.org/cgi/co...bstract/gkq332
    Attached Files

    Leave a comment:


  • Aero
    replied
    Hi AKroxy,

    Sorry for the typo and thank you for pointing it out...I actually meant a T-overhang for the adaptor. And it's a 3' A-overhang for the insert.

    Leave a comment:


  • AKroxy
    replied
    I was told that there was an overhang (shouldn't it be a T?) by someone at Roche that I spoke to on the phone. I don't know why it doesn't appear in the sequences above. Often the emails from my rep are cryptic and confusing.

    Leave a comment:


  • Aero
    replied
    Rapid Library Adpators

    I thought there should be a 3' A-overhang after the key sequence for TA-ligation of insert and adaptor...is that correct?

    Leave a comment:


  • 0Gen
    replied
    This Y adaptor variant might be of interest.

    Last edited by 0Gen; 05-05-2010, 06:55 AM.

    Leave a comment:


  • pmiguel
    replied
    Originally posted by dottomarco View Post
    Thanks a lot AKroxy ! Roche reps around the word must have different conception of "confidential" information.
    At list now we know that the adaptors are the same as the "standard" adaptors except for the key sequence that still remains unknown.
    Rapid libraries use "GACT" as the key bases.

    --
    Phillip

    Leave a comment:


  • dottomarco
    replied
    Thanks a lot AKroxy ! Roche reps around the word must have different conception of "confidential" information.
    At list now we know that the adaptors are the same as the "standard" adaptors except for the key sequence that still remains unknown.

    Leave a comment:


  • AKroxy
    replied
    Here is the info I got from the Roche rep when I asked for the RAPID adaptor sequences so I could design PCR primers.

    The adaptors are double stranded. The sequences TCAG at 3' end of each long adaptor strand are the general Ti shotgun key sequences. The key sequence is different with Rapid Library. The following figure will help in explaining better. You can order the Primers below to check your library.

    emPCR Primer A 5' CCATCTCATCCCTGCGTGTC 3'
    TI A Adaptor 5' CCATCTCATCCCTGCGTGTCTCCGACTCAG 3'
    3' AGAGGCTGAGTC 5'

    emPCR Primer B 5' CCTATCCCCTGTGTGCCTTG 3'
    TI B Adaptor 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG 3'
    3' ACCGTCAGAGTC 5'

    Leave a comment:


  • dottomarco
    replied
    We need to amplify the rapid library and I really do not understand the point of not let the users know what the adaptor's sequences are?
    Any idea on how to design a couple of primers to amplify the rapid libraries?

    Leave a comment:


  • pmiguel
    replied
    Originally posted by dottomarco View Post
    Hy ulz_peter. I have that exact pdf, but it is the TECHNICALM BULLETIN for the amplicon protocol titanium.
    I am sewarching for the exact same correspondent for the RAPID LIBRARIES.
    The picture of the adaptors etc is pre-rapid as you can see from the fact that adaptor A does not have FAM attached to it.
    I assume both A and B adaptors, the key sequence and the MIDs have changed with the new protocol: RAPID. And that information is exactly the one I was searching for.
    Thanks
    Roche is not releasing the sequence of their RAPID adaptors. I have heard company reps refer to them as "hairpin" adaptors, however. So it is possible you might be able to infer their sequence from a sequence run. That said, I gave it a shot with our first RAPID run and nothing obvious was leaping out at me. The B-adaptor sequence (non-barcoded in this case) seemed the same as the non-RAPID B-adaptor sequence.

    As Roche now had a deal with IDT here in the US to provide extra barcodes if the limited number offered in the RAPID kit (12) are not sufficient, my anger at Roche for withholding this information is somewhat ameliorated.

    --
    Phillip

    Leave a comment:


  • dottomarco
    replied
    Hy ulz_peter. I have that exact pdf, but it is the TECHNICALM BULLETIN for the amplicon protocol titanium.
    I am sewarching for the exact same correspondent for the RAPID LIBRARIES.
    The picture of the adaptors etc is pre-rapid as you can see from the fact that adaptor A does not have FAM attached to it.
    I assume both A and B adaptors, the key sequence and the MIDs have changed with the new protocol: RAPID. And that information is exactly the one I was searching for.
    Thanks

    Leave a comment:


  • ulz_peter
    replied
    Maybe this file can help you,
    However I've got no idea of the MID sequences (so far).
    Attached Files

    Leave a comment:

Latest Articles

Collapse

  • seqadmin
    Exploring the Dynamics of the Tumor Microenvironment
    by seqadmin




    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
    07-08-2024, 03:19 PM
  • seqadmin
    Exploring Human Diversity Through Large-Scale Omics
    by seqadmin


    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
    06-25-2024, 06:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 07-10-2024, 07:30 AM
0 responses
30 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 09:45 AM
0 responses
202 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 08:54 AM
0 responses
212 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-02-2024, 03:00 PM
0 responses
194 views
0 likes
Last Post seqadmin  
Working...
X