Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • RAPID Libraries adaptor+key sequences

    I was wondering if any of you know what the adaptors A and B sequences are (+ key sequence).
    Even better if you can also provide the MID sequences of the kit that is shipped by Roche for the rapid library protocol

    Thank you

  • #2
    Maybe this file can help you,
    However I've got no idea of the MID sequences (so far).
    Attached Files


    • #3
      Hy ulz_peter. I have that exact pdf, but it is the TECHNICALM BULLETIN for the amplicon protocol titanium.
      I am sewarching for the exact same correspondent for the RAPID LIBRARIES.
      The picture of the adaptors etc is pre-rapid as you can see from the fact that adaptor A does not have FAM attached to it.
      I assume both A and B adaptors, the key sequence and the MIDs have changed with the new protocol: RAPID. And that information is exactly the one I was searching for.


      • #4
        Originally posted by dottomarco View Post
        Hy ulz_peter. I have that exact pdf, but it is the TECHNICALM BULLETIN for the amplicon protocol titanium.
        I am sewarching for the exact same correspondent for the RAPID LIBRARIES.
        The picture of the adaptors etc is pre-rapid as you can see from the fact that adaptor A does not have FAM attached to it.
        I assume both A and B adaptors, the key sequence and the MIDs have changed with the new protocol: RAPID. And that information is exactly the one I was searching for.
        Roche is not releasing the sequence of their RAPID adaptors. I have heard company reps refer to them as "hairpin" adaptors, however. So it is possible you might be able to infer their sequence from a sequence run. That said, I gave it a shot with our first RAPID run and nothing obvious was leaping out at me. The B-adaptor sequence (non-barcoded in this case) seemed the same as the non-RAPID B-adaptor sequence.

        As Roche now had a deal with IDT here in the US to provide extra barcodes if the limited number offered in the RAPID kit (12) are not sufficient, my anger at Roche for withholding this information is somewhat ameliorated.



        • #5
          We need to amplify the rapid library and I really do not understand the point of not let the users know what the adaptor's sequences are?
          Any idea on how to design a couple of primers to amplify the rapid libraries?


          • #6
            Here is the info I got from the Roche rep when I asked for the RAPID adaptor sequences so I could design PCR primers.

            The adaptors are double stranded. The sequences TCAG at 3' end of each long adaptor strand are the general Ti shotgun key sequences. The key sequence is different with Rapid Library. The following figure will help in explaining better. You can order the Primers below to check your library.

            emPCR Primer A 5' CCATCTCATCCCTGCGTGTC 3'
            3' AGAGGCTGAGTC 5'

            emPCR Primer B 5' CCTATCCCCTGTGTGCCTTG 3'
            3' ACCGTCAGAGTC 5'


            • #7
              Thanks a lot AKroxy ! Roche reps around the word must have different conception of "confidential" information.
              At list now we know that the adaptors are the same as the "standard" adaptors except for the key sequence that still remains unknown.


              • #8
                Originally posted by dottomarco View Post
                Thanks a lot AKroxy ! Roche reps around the word must have different conception of "confidential" information.
                At list now we know that the adaptors are the same as the "standard" adaptors except for the key sequence that still remains unknown.
                Rapid libraries use "GACT" as the key bases.



                • #9
                  This Y adaptor variant might be of interest.

                  Last edited by 0Gen; 05-05-2010, 06:55 AM.


                  • #10
                    Rapid Library Adpators

                    I thought there should be a 3' A-overhang after the key sequence for TA-ligation of insert and that correct?


                    • #11
                      I was told that there was an overhang (shouldn't it be a T?) by someone at Roche that I spoke to on the phone. I don't know why it doesn't appear in the sequences above. Often the emails from my rep are cryptic and confusing.


                      • #12
                        Hi AKroxy,

                        Sorry for the typo and thank you for pointing it out...I actually meant a T-overhang for the adaptor. And it's a 3' A-overhang for the insert.


                        • #13

                          The RL adaptor seems to be a Roche secret. There is a recent paper uses an Y adatpor + Taqman-MGB qPCR + Poisson distribution.

                          ..............................................||||| | | | | |

                          A single Y adaptor has adavantages over two adaptors (A and B), as it showed in Fig.1.

                          Attached Files


                          • #14
                            I don't know, if the sequence of the rapid adaptors is still of interest, but here is an official document from roche.

                            Attached Files


                            • #15
                              Thanks for posting that document, tokikake! I looked and looked and couldn't find that anywhere!


                              Latest Articles


                              • seqadmin
                                Current Approaches to Protein Sequencing
                                by seqadmin

                                Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                                04-04-2024, 04:25 PM
                              • seqadmin
                                Strategies for Sequencing Challenging Samples
                                by seqadmin

                                Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
                                03-22-2024, 06:39 AM





                              Topics Statistics Last Post
                              Started by seqadmin, 04-11-2024, 12:08 PM
                              0 responses
                              Last Post seqadmin  
                              Started by seqadmin, 04-10-2024, 10:19 PM
                              0 responses
                              Last Post seqadmin  
                              Started by seqadmin, 04-10-2024, 09:21 AM
                              0 responses
                              Last Post seqadmin  
                              Started by seqadmin, 04-04-2024, 09:00 AM
                              0 responses
                              Last Post seqadmin  