Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • dottomarco
    Member
    • Jul 2009
    • 32

    RAPID Libraries adaptor+key sequences

    I was wondering if any of you know what the adaptors A and B sequences are (+ key sequence).
    Even better if you can also provide the MID sequences of the kit that is shipped by Roche for the rapid library protocol

    Thank you
  • ulz_peter
    Senior Member
    • Feb 2010
    • 219

    #2
    Maybe this file can help you,
    However I've got no idea of the MID sequences (so far).
    Attached Files

    Comment

    • dottomarco
      Member
      • Jul 2009
      • 32

      #3
      Hy ulz_peter. I have that exact pdf, but it is the TECHNICALM BULLETIN for the amplicon protocol titanium.
      I am sewarching for the exact same correspondent for the RAPID LIBRARIES.
      The picture of the adaptors etc is pre-rapid as you can see from the fact that adaptor A does not have FAM attached to it.
      I assume both A and B adaptors, the key sequence and the MIDs have changed with the new protocol: RAPID. And that information is exactly the one I was searching for.
      Thanks

      Comment

      • pmiguel
        Senior Member
        • Aug 2008
        • 2328

        #4
        Originally posted by dottomarco View Post
        Hy ulz_peter. I have that exact pdf, but it is the TECHNICALM BULLETIN for the amplicon protocol titanium.
        I am sewarching for the exact same correspondent for the RAPID LIBRARIES.
        The picture of the adaptors etc is pre-rapid as you can see from the fact that adaptor A does not have FAM attached to it.
        I assume both A and B adaptors, the key sequence and the MIDs have changed with the new protocol: RAPID. And that information is exactly the one I was searching for.
        Thanks
        Roche is not releasing the sequence of their RAPID adaptors. I have heard company reps refer to them as "hairpin" adaptors, however. So it is possible you might be able to infer their sequence from a sequence run. That said, I gave it a shot with our first RAPID run and nothing obvious was leaping out at me. The B-adaptor sequence (non-barcoded in this case) seemed the same as the non-RAPID B-adaptor sequence.

        As Roche now had a deal with IDT here in the US to provide extra barcodes if the limited number offered in the RAPID kit (12) are not sufficient, my anger at Roche for withholding this information is somewhat ameliorated.

        --
        Phillip

        Comment

        • dottomarco
          Member
          • Jul 2009
          • 32

          #5
          We need to amplify the rapid library and I really do not understand the point of not let the users know what the adaptor's sequences are?
          Any idea on how to design a couple of primers to amplify the rapid libraries?

          Comment

          • AKroxy
            Member
            • May 2009
            • 20

            #6
            Here is the info I got from the Roche rep when I asked for the RAPID adaptor sequences so I could design PCR primers.

            The adaptors are double stranded. The sequences TCAG at 3' end of each long adaptor strand are the general Ti shotgun key sequences. The key sequence is different with Rapid Library. The following figure will help in explaining better. You can order the Primers below to check your library.

            emPCR Primer A 5' CCATCTCATCCCTGCGTGTC 3'
            TI A Adaptor 5' CCATCTCATCCCTGCGTGTCTCCGACTCAG 3'
            3' AGAGGCTGAGTC 5'

            emPCR Primer B 5' CCTATCCCCTGTGTGCCTTG 3'
            TI B Adaptor 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG 3'
            3' ACCGTCAGAGTC 5'

            Comment

            • dottomarco
              Member
              • Jul 2009
              • 32

              #7
              Thanks a lot AKroxy ! Roche reps around the word must have different conception of "confidential" information.
              At list now we know that the adaptors are the same as the "standard" adaptors except for the key sequence that still remains unknown.

              Comment

              • pmiguel
                Senior Member
                • Aug 2008
                • 2328

                #8
                Originally posted by dottomarco View Post
                Thanks a lot AKroxy ! Roche reps around the word must have different conception of "confidential" information.
                At list now we know that the adaptors are the same as the "standard" adaptors except for the key sequence that still remains unknown.
                Rapid libraries use "GACT" as the key bases.

                --
                Phillip

                Comment

                • 0Gen
                  Junior Member
                  • Mar 2010
                  • 8

                  #9
                  This Y adaptor variant might be of interest.

                  Last edited by 0Gen; 05-05-2010, 06:55 AM.

                  Comment

                  • Aero
                    Junior Member
                    • Jun 2009
                    • 4

                    #10
                    Rapid Library Adpators

                    I thought there should be a 3' A-overhang after the key sequence for TA-ligation of insert and adaptor...is that correct?

                    Comment

                    • AKroxy
                      Member
                      • May 2009
                      • 20

                      #11
                      I was told that there was an overhang (shouldn't it be a T?) by someone at Roche that I spoke to on the phone. I don't know why it doesn't appear in the sequences above. Often the emails from my rep are cryptic and confusing.

                      Comment

                      • Aero
                        Junior Member
                        • Jun 2009
                        • 4

                        #12
                        Hi AKroxy,

                        Sorry for the typo and thank you for pointing it out...I actually meant a T-overhang for the adaptor. And it's a 3' A-overhang for the insert.

                        Comment

                        • 0Gen
                          Junior Member
                          • Mar 2010
                          • 8

                          #13
                          Hi,

                          The RL adaptor seems to be a Roche secret. There is a recent paper uses an Y adatpor + Taqman-MGB qPCR + Poisson distribution.

                          ..................5'C*C*A*T*C*T*CATCCCTGCGTGTCTCCGA*C*T*C*A*G*T3'
                          ..............................................||||| | | | | |
                          3'G*G*A*T*A*G*GGGACACACGGAACAGATAGGGGACAACGCACAGGCT*G*A*G*T*Cp5'



                          A single Y adaptor has adavantages over two adaptors (A and B), as it showed in Fig.1.

                          http://nar.oxfordjournals.org/cgi/co...bstract/gkq332
                          Attached Files

                          Comment

                          • tokikake
                            Member
                            • Nov 2011
                            • 24

                            #14
                            I don't know, if the sequence of the rapid adaptors is still of interest, but here is an official document from roche.

                            Cheers!
                            Attached Files

                            Comment

                            • orangekel13
                              Junior Member
                              • Aug 2011
                              • 1

                              #15
                              Thanks for posting that document, tokikake! I looked and looked and couldn't find that anywhere!

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM
                              • SEQadmin2
                                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                by SEQadmin2



                                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                07-08-2026, 05:17 AM
                              • GATTACAT
                                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                by GATTACAT
                                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                07-01-2026, 11:43 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 07-13-2026, 10:26 AM
                              0 responses
                              20 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-09-2026, 10:04 AM
                              0 responses
                              31 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-08-2026, 10:08 AM
                              0 responses
                              20 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-07-2026, 11:05 AM
                              0 responses
                              34 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...