Velvet postprocessing problem

[khikho]

when I run Postprocessor script (version 1.6 ) on my contigs (make them by velvet) I got these bunch of errors which are repeated million times , could you give me hint to handle these errors!?
I don't know which info should I give to make the situation clear so ask me what ever makes it more clear for you!?

Use of uninitialized value $seq_id in print at Package/denovo_postprocessor_solid_v1.6.pl line 243, <OUT> line 272998.
Use of uninitialized value $seq_id in split at Package/denovo_postprocessor_solid_v1.6.pl line 245, <OUT> line 272998.
Use of uninitialized value $seq in split at Package/denovo_postprocessor_solid_v1.6.pl line 272, <OUT> line 272998.
Use of uninitialized value $seq_id in string at Package/denovo_postprocessor_solid_v1.6.pl line 342, <OUT> line 272998.
Use of uninitialized value $seq in concatenation (.) or string at Package/denovo_postprocessor_solid_v1.6.pl line 343, <OUT> line 272998.
format of input wrong

BTW I plan to assemble human genome.
Thanks

[colindaven]

It's an input format error. I think this package requires an older version of Velvet.

Why not try assembling a small subset of reads with the older Velvet version and seeing if you can get that to run ?

[sisch]

Could be an issue with the fasta headers. Could you post the first two contigs including the headers from your contigs.fa file?

[khikho]

>NODE_5_length_25_cov_2.560000
GGAAGGGCCCAAGCAACATATGGGATCGAAGAGAGCCCAGCACGGACTC
>NODE_7_length_25_cov_2.240000
AAACTAAACAAAACTAAACTAAACGAAACTAGACTAAACTAAACTAGAC
>NODE_10_length_25_cov_7.920000
GAAGGGCCACTTGGCAGCGAAGTGAAGAGTATCCAGCCGAGACGGTTCg
>NODE_35_length_44_cov_7.863636
TAACATAACATAAATCCAGTTAACATAACGTAACTAAAACTAATATAAACTAAACTAAGGTACACTAA

[sisch]

It seems you're trying to postprocess basespace data (as you posted) with a colorspace script (postprocessor_SOLID_v1.6.pl).

However, I'm lacking experience with the postprocessor script, so this is the only hint I can give.

[jjjscuedu]

velveth Kmer length

Hi all,

I was trying to use the velveth to analysis my RNAseq dataset.

My reads length is 101.

However, when I try to set the Kmer of velveth to 81, there is a problem:

velveth cannot handle the kmer as long as 81.


Hence, i want to ask what the reasonable value for kmer for the read length.

Thanks!

Jingjing

[colindaven]

jjjscuedu:

Try first trimming the low quality read ends. Use FastQC to visualise.

Then we have used successfully used kmer parameters between 33 and 45 for reads of that length. We could test values quite easily because we knew the expected genome sizes of 20 bacterial genomes, and tried to maximise for that.