Hi, I am having some trouble running some SOLiD data through bowtie. I've converted from csfasta/qual files to fastq using solid2fastq (v0.6.3c) and get this:
@424_1953_1910
T23311000033011331110003320301300033203123032220022
+
<99>=9=::=7<8;:5,,4/<<77@37-52=5.):.7$91450)=4:%&:
Now I know the first base is the adaptor, but I assume the difference in length of the sequence and qual data is to be expected.
Then I run through bowtie (v0.12.2) using just the -S -C options. But when I run 'samtools import' on the resulting SAM file, I get:
Parse error at line 96: sequence and quality are inconsistent
It's only the unmapped reads that cause this problem, the mapped ones are ok. Here's an example:
424_1953_1812 4 * 0 0 * * 0 0 TAGGACAAGAGCATACTCTGCTAGCAAAATCTAGATGCCAGATCTGGAG 948;<<:4:>:<<;>8:;:=5:><1;;<95089:22/8:36;2198;+^@ XM:i:0
The '^@' is present in the unmapped reads but not the mapped ones.
So, (a) is this a bug in bowtie or samtools? and (b) is there a way to suppress the unmapped reads in the bowtie SAM output, which would work around this problem.
Thanks!
Will
@424_1953_1910
T23311000033011331110003320301300033203123032220022
+
<99>=9=::=7<8;:5,,4/<<77@37-52=5.):.7$91450)=4:%&:
Now I know the first base is the adaptor, but I assume the difference in length of the sequence and qual data is to be expected.
Then I run through bowtie (v0.12.2) using just the -S -C options. But when I run 'samtools import' on the resulting SAM file, I get:
Parse error at line 96: sequence and quality are inconsistent
It's only the unmapped reads that cause this problem, the mapped ones are ok. Here's an example:
424_1953_1812 4 * 0 0 * * 0 0 TAGGACAAGAGCATACTCTGCTAGCAAAATCTAGATGCCAGATCTGGAG 948;<<:4:>:<<;>8:;:=5:><1;;<95089:22/8:36;2198;+^@ XM:i:0
The '^@' is present in the unmapped reads but not the mapped ones.
So, (a) is this a bug in bowtie or samtools? and (b) is there a way to suppress the unmapped reads in the bowtie SAM output, which would work around this problem.
Thanks!
Will
Comment