Unconfigured Ad

Collapse
This is a sticky topic.
X
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • exprofiler
    Junior Member
    • Sep 2008
    • 2

    SOLiD Adapters

    Hello,
    I would like to sequence gene expression tags with the SOliD machine-does anybody have the adapter-sequences flanking the inserts or do you know where could I get them?
    Also, is there a relaible service provider for the SOliD system out there ?
    Thank you very much in advance!
  • universalprimer
    Junior Member
    • Sep 2008
    • 1

    #2
    Here are the sequences for most of the current solid oligos, I tried to display it like the post in the solexa forum. I don't know the sequences of the P1 primer on the bead, the actual sequencing primers, or all the "block" oligos.

    SOLiD 2.0 Oligos

    P1 Adapter:
    5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (-) -------------------- -------------------- - 3'
    3' ---------------TTGG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (-) -------------------- -------------------- - 5'

    P2 Adapter:
    5' -------------------- -------------------- ------------------ (-) AGAGAATGAGGAACCCGGGG CAGTT--------------- - 3'
    3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'

    Library PCR Primer1:
    5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATG------------- (-) -------------------- -------------------- - 3'
    3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 5'

    Library PCR Primer2:
    5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 3'
    3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'

    Resulting Frag Library:
    5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (N) AGAGAATGAGGAACCCGGGG CAG----------------- - 3'
    3' -----------------GG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (N) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'


    Mate pair oligos

    EcoP15I Cap Adapter (note AC 3' overhang on one end)
    5' -------pCTGCTGTAC---------- - 3'
    3' --------GACGACAp----------- - 5'

    Internal Adapter (note: lowercase T in top strand has internal biotin, note GT 3' overhangs for sticky end circularization)
    5' --------CGTACAtCCGCCTTGGCCGT----- - 3'
    3' ------TGGCATGTAGGCGGAACCGG------- - 5'
    Last edited by universalprimer; 09-28-2008, 12:29 PM.

    Comment

    • exprofiler
      Junior Member
      • Sep 2008
      • 2

      #3
      thank you !!

      Comment

      • snetmcom
        Senior Member
        • Oct 2008
        • 159

        #4
        there are a few service providers out there. Your best bet would be to contact ABI. Seqwright and Agencourt are the two big ones, but I wouldnt send my samples anywhere other than agencourt.

        Comment

        • atp
          Junior Member
          • Sep 2008
          • 3

          #5
          Does anybody know the sequence of the multiplexing adapters (barcoding) for the SOLiD system?

          Comment

          • Chipper
            Senior Member
            • Mar 2008
            • 323

            #6
            Yes, but you should contact ABI since it is not officaly released yet...

            Comment

            • mulligan
              Junior Member
              • May 2009
              • 2

              #7
              Y-Based SOLiD Adaptors

              Has anyone heard if AB was planning on switching to Y-based adaptors and A- tailing for fragment libraries?

              Comment

              • pmiguel
                Senior Member
                • Aug 2008
                • 2328

                #8
                Originally posted by mulligan View Post
                Has anyone heard if AB was planning on switching to Y-based adaptors and A- tailing for fragment libraries?
                I have not heard anything along those lines. Seems like there would be a down side to y-adaptors. They would introduce some self-complementarity into the amplicons that could make the template strands less available for replication. And if you plan on doing any pre-ePCR PCR at all, they are unnecessary because the PCR "suppression effect" drastically favors amplification of amplicons not flanked by the same adaptor type.

                --
                Phillip

                Comment

                • AdrianCarr
                  Junior Member
                  • Jun 2009
                  • 1

                  #9
                  Does anyone know the sequence of the 'LMP CAP Adapter' used in the long mate-paired protocol? I assume it is similar to the EcoP15I Cap Adapter...

                  Thanks

                  Adrian

                  Comment

                  • Nitrogen-DNE-sulfer
                    Member
                    • Aug 2009
                    • 20

                    #10
                    I saw a slide at AGBT which suggested AB is making sequencing primers to allow customers to sequence their ILMN libraries on SOLiD. These would leverage the Y adaptors.
                    Speaking to the Invitrogen people, TA cloning is much more efficient than blunt cloning and can be leveraged with either approach. If you look at oligos above you can remove one A from them (near the N) and get them to be compliant with TA cloning. You probably need to tweak the adaptor to insert ratio to reduce dimers as blunt requires a lot more adaptor.
                    Also need to alter the end repair reaction to ensure PlusA. The Sequencing primers should be unaffected as the Plus A is just replicating the 3'A on the oligo so the end molecules is the same.

                    We've also seen the use of thioates on the TT overhangs to help. We see the adaptors over time or with different oligo lots have a different propensity to form dimers. We attribute this to the TT tails being hydrolyzed or exo'd and thus the dimer which forms is 60-70bp. The only way this dimer size makes sense is if there is tail to tail dimerization which then dimerizes again.
                    would love to know if anyone has sanger sequenced these to confirm what the dimers are as the size after PCR doesnt make sense unless more than 2 molecules are coming together.

                    I think the biggest pick up is in A-Tailing. The Y-adaptors on paper should help get 2 X more as every strand gets P1 and P2 where as the AB method is a punnett square with P1-P1 and P2-P2 molecules being formed but presumably not amplifying so 50% of the inserts are wasted. The reason I say on paper is I have heard the Y-adaptors have some suppression PCR effects as well and havent seen a direct comparison of the yield between the methods.

                    Comment

                    • pmiguel
                      Senior Member
                      • Aug 2008
                      • 2328

                      #11
                      Originally posted by Nitrogen-DNE-sulfer View Post
                      I think the biggest pick up is in A-Tailing. The Y-adaptors on paper should help get 2 X more as every strand gets P1 and P2 where as the AB method is a punnett square with P1-P1 and P2-P2 molecules being formed but presumably not amplifying so 50% of the inserts are wasted. The reason I say on paper is I have heard the Y-adaptors have some suppression PCR effects as well and havent seen a direct comparison of the yield between the methods.
                      2x seems like a lot--but is it? As we have discussed before, these protocols are so inefficient that they often have you start with a million-fold more sample molecules than actually end up making it through the full procedure. (With Illumina and SOLiD protocol it is hard to even estimate what the final molecular yield is, because they generally will entail at least some PCR amplification along the way.)

                      Are blunt end ligations really less efficient than single base 3' complementary base overhangs? Historically the T-tailed cloning vectors seemed to become popular as quick ways to clone PCR products. But this was because Taq polymerase added a non-templated 3' A base. And Taq is the very devil to get rid of (being thermostable and all) sufficiently that polishing enzymes could remove the base without the A just getting added back again. Basically you could row upsteam or downstream with your protocol.

                      --
                      Phillip

                      Comment

                      • volks
                        Member
                        • Jun 2010
                        • 80

                        #12
                        Originally posted by AdrianCarr View Post
                        Does anyone know the sequence of the 'LMP CAP Adapter' used in the long mate-paired protocol? I assume it is similar to the EcoP15I Cap Adapter...
                        I would also be interested. Also, does someone know which part is required for ligation primer hybridization (or the sequence of the ligation primer)?

                        Comment

                        • pmiguel
                          Senior Member
                          • Aug 2008
                          • 2328

                          #13
                          Originally posted by volks View Post
                          I would also be interested. Also, does someone know which part is required for ligation primer hybridization (or the sequence of the ligation primer)?
                          The internal and cap adaptor sequences were posted up thread:




                          The internal adaptor+ CAP Adaptors ligate into:

                          5'-CTGCTGTACCGTACATCCGCCTTGGCCGTACAGCAG-3'

                          The 3' terminus, or there about, would be your ligation primer. I'm not sure the exact length.

                          --
                          Phillip

                          Comment

                          • volks
                            Member
                            • Jun 2010
                            • 80

                            #14
                            The question was whether the 'EcoP15I Cap Adapter' and the 'LMP CAP Adapter' are the same. So far I couldn't find the 'LMP CAP Adapter' sequence.

                            Comment

                            • pmiguel
                              Senior Member
                              • Aug 2008
                              • 2328

                              #15
                              Originally posted by volks View Post
                              The question was whether the 'EcoP15I Cap Adapter' and the 'LMP CAP Adapter' are the same. So far I couldn't find the 'LMP CAP Adapter' sequence.
                              They have the same sequence. They differ only in the 5' phosphorylation state of the shorter oligo. This is from p. 206 of the SOLiD 4 System Library Preparation Guide:

                              EcoP15I CAP Adaptor, 50 µM
                              5′ Phos-CTGCTGTAC-3′
                              5′ Phos-ACAGCAG-3′

                              LMP CAP Adaptor, 50 µM
                              5′ Phos-CTGCTGTAC-3′
                              5′ -ACAGCAG-3′

                              --
                              Phillip

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                by SEQadmin2


                                Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                The systematic characterization of the human proteome has
                                ...
                                07-20-2026, 11:48 AM
                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM
                              • SEQadmin2
                                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                by SEQadmin2



                                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                07-08-2026, 05:17 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 07-24-2026, 12:17 PM
                              0 responses
                              31 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-23-2026, 11:41 AM
                              0 responses
                              23 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-20-2026, 11:10 AM
                              0 responses
                              215 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-13-2026, 10:26 AM
                              0 responses
                              79 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...