Unconfigured Ad

Collapse
This is a sticky topic.
X
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • exprofiler
    Junior Member
    • Sep 2008
    • 2

    SOLiD Adapters

    Hello,
    I would like to sequence gene expression tags with the SOliD machine-does anybody have the adapter-sequences flanking the inserts or do you know where could I get them?
    Also, is there a relaible service provider for the SOliD system out there ?
    Thank you very much in advance!
  • universalprimer
    Junior Member
    • Sep 2008
    • 1

    #2
    Here are the sequences for most of the current solid oligos, I tried to display it like the post in the solexa forum. I don't know the sequences of the P1 primer on the bead, the actual sequencing primers, or all the "block" oligos.

    SOLiD 2.0 Oligos

    P1 Adapter:
    5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (-) -------------------- -------------------- - 3'
    3' ---------------TTGG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (-) -------------------- -------------------- - 5'

    P2 Adapter:
    5' -------------------- -------------------- ------------------ (-) AGAGAATGAGGAACCCGGGG CAGTT--------------- - 3'
    3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'

    Library PCR Primer1:
    5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATG------------- (-) -------------------- -------------------- - 3'
    3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 5'

    Library PCR Primer2:
    5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 3'
    3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'

    Resulting Frag Library:
    5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (N) AGAGAATGAGGAACCCGGGG CAG----------------- - 3'
    3' -----------------GG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (N) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'


    Mate pair oligos

    EcoP15I Cap Adapter (note AC 3' overhang on one end)
    5' -------pCTGCTGTAC---------- - 3'
    3' --------GACGACAp----------- - 5'

    Internal Adapter (note: lowercase T in top strand has internal biotin, note GT 3' overhangs for sticky end circularization)
    5' --------CGTACAtCCGCCTTGGCCGT----- - 3'
    3' ------TGGCATGTAGGCGGAACCGG------- - 5'
    Last edited by universalprimer; 09-28-2008, 12:29 PM.

    Comment

    • exprofiler
      Junior Member
      • Sep 2008
      • 2

      #3
      thank you !!

      Comment

      • snetmcom
        Senior Member
        • Oct 2008
        • 159

        #4
        there are a few service providers out there. Your best bet would be to contact ABI. Seqwright and Agencourt are the two big ones, but I wouldnt send my samples anywhere other than agencourt.

        Comment

        • atp
          Junior Member
          • Sep 2008
          • 3

          #5
          Does anybody know the sequence of the multiplexing adapters (barcoding) for the SOLiD system?

          Comment

          • Chipper
            Senior Member
            • Mar 2008
            • 323

            #6
            Yes, but you should contact ABI since it is not officaly released yet...

            Comment

            • mulligan
              Junior Member
              • May 2009
              • 2

              #7
              Y-Based SOLiD Adaptors

              Has anyone heard if AB was planning on switching to Y-based adaptors and A- tailing for fragment libraries?

              Comment

              • pmiguel
                Senior Member
                • Aug 2008
                • 2328

                #8
                Originally posted by mulligan View Post
                Has anyone heard if AB was planning on switching to Y-based adaptors and A- tailing for fragment libraries?
                I have not heard anything along those lines. Seems like there would be a down side to y-adaptors. They would introduce some self-complementarity into the amplicons that could make the template strands less available for replication. And if you plan on doing any pre-ePCR PCR at all, they are unnecessary because the PCR "suppression effect" drastically favors amplification of amplicons not flanked by the same adaptor type.

                --
                Phillip

                Comment

                • AdrianCarr
                  Junior Member
                  • Jun 2009
                  • 1

                  #9
                  Does anyone know the sequence of the 'LMP CAP Adapter' used in the long mate-paired protocol? I assume it is similar to the EcoP15I Cap Adapter...

                  Thanks

                  Adrian

                  Comment

                  • Nitrogen-DNE-sulfer
                    Member
                    • Aug 2009
                    • 20

                    #10
                    I saw a slide at AGBT which suggested AB is making sequencing primers to allow customers to sequence their ILMN libraries on SOLiD. These would leverage the Y adaptors.
                    Speaking to the Invitrogen people, TA cloning is much more efficient than blunt cloning and can be leveraged with either approach. If you look at oligos above you can remove one A from them (near the N) and get them to be compliant with TA cloning. You probably need to tweak the adaptor to insert ratio to reduce dimers as blunt requires a lot more adaptor.
                    Also need to alter the end repair reaction to ensure PlusA. The Sequencing primers should be unaffected as the Plus A is just replicating the 3'A on the oligo so the end molecules is the same.

                    We've also seen the use of thioates on the TT overhangs to help. We see the adaptors over time or with different oligo lots have a different propensity to form dimers. We attribute this to the TT tails being hydrolyzed or exo'd and thus the dimer which forms is 60-70bp. The only way this dimer size makes sense is if there is tail to tail dimerization which then dimerizes again.
                    would love to know if anyone has sanger sequenced these to confirm what the dimers are as the size after PCR doesnt make sense unless more than 2 molecules are coming together.

                    I think the biggest pick up is in A-Tailing. The Y-adaptors on paper should help get 2 X more as every strand gets P1 and P2 where as the AB method is a punnett square with P1-P1 and P2-P2 molecules being formed but presumably not amplifying so 50% of the inserts are wasted. The reason I say on paper is I have heard the Y-adaptors have some suppression PCR effects as well and havent seen a direct comparison of the yield between the methods.

                    Comment

                    • pmiguel
                      Senior Member
                      • Aug 2008
                      • 2328

                      #11
                      Originally posted by Nitrogen-DNE-sulfer View Post
                      I think the biggest pick up is in A-Tailing. The Y-adaptors on paper should help get 2 X more as every strand gets P1 and P2 where as the AB method is a punnett square with P1-P1 and P2-P2 molecules being formed but presumably not amplifying so 50% of the inserts are wasted. The reason I say on paper is I have heard the Y-adaptors have some suppression PCR effects as well and havent seen a direct comparison of the yield between the methods.
                      2x seems like a lot--but is it? As we have discussed before, these protocols are so inefficient that they often have you start with a million-fold more sample molecules than actually end up making it through the full procedure. (With Illumina and SOLiD protocol it is hard to even estimate what the final molecular yield is, because they generally will entail at least some PCR amplification along the way.)

                      Are blunt end ligations really less efficient than single base 3' complementary base overhangs? Historically the T-tailed cloning vectors seemed to become popular as quick ways to clone PCR products. But this was because Taq polymerase added a non-templated 3' A base. And Taq is the very devil to get rid of (being thermostable and all) sufficiently that polishing enzymes could remove the base without the A just getting added back again. Basically you could row upsteam or downstream with your protocol.

                      --
                      Phillip

                      Comment

                      • volks
                        Member
                        • Jun 2010
                        • 80

                        #12
                        Originally posted by AdrianCarr View Post
                        Does anyone know the sequence of the 'LMP CAP Adapter' used in the long mate-paired protocol? I assume it is similar to the EcoP15I Cap Adapter...
                        I would also be interested. Also, does someone know which part is required for ligation primer hybridization (or the sequence of the ligation primer)?

                        Comment

                        • pmiguel
                          Senior Member
                          • Aug 2008
                          • 2328

                          #13
                          Originally posted by volks View Post
                          I would also be interested. Also, does someone know which part is required for ligation primer hybridization (or the sequence of the ligation primer)?
                          The internal and cap adaptor sequences were posted up thread:




                          The internal adaptor+ CAP Adaptors ligate into:

                          5'-CTGCTGTACCGTACATCCGCCTTGGCCGTACAGCAG-3'

                          The 3' terminus, or there about, would be your ligation primer. I'm not sure the exact length.

                          --
                          Phillip

                          Comment

                          • volks
                            Member
                            • Jun 2010
                            • 80

                            #14
                            The question was whether the 'EcoP15I Cap Adapter' and the 'LMP CAP Adapter' are the same. So far I couldn't find the 'LMP CAP Adapter' sequence.

                            Comment

                            • pmiguel
                              Senior Member
                              • Aug 2008
                              • 2328

                              #15
                              Originally posted by volks View Post
                              The question was whether the 'EcoP15I Cap Adapter' and the 'LMP CAP Adapter' are the same. So far I couldn't find the 'LMP CAP Adapter' sequence.
                              They have the same sequence. They differ only in the 5' phosphorylation state of the shorter oligo. This is from p. 206 of the SOLiD 4 System Library Preparation Guide:

                              EcoP15I CAP Adaptor, 50 µM
                              5′ Phos-CTGCTGTAC-3′
                              5′ Phos-ACAGCAG-3′

                              LMP CAP Adaptor, 50 µM
                              5′ Phos-CTGCTGTAC-3′
                              5′ -ACAGCAG-3′

                              --
                              Phillip

                              Comment

                              Latest Articles

                              Collapse

                              • GATTACAT
                                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                by GATTACAT
                                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                Yesterday, 11:43 AM
                              • SEQadmin2
                                Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                by SEQadmin2


                                I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

                                Here are nine questions we think about, in roughly the order they matter, before...
                                06-18-2026, 07:11 AM
                              • SEQadmin2
                                From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
                                by SEQadmin2


                                Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


                                The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
                                ...
                                06-02-2026, 10:05 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 06-30-2026, 05:37 AM
                              0 responses
                              9 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-26-2026, 11:10 AM
                              0 responses
                              18 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-17-2026, 06:09 AM
                              0 responses
                              52 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-09-2026, 11:58 AM
                              0 responses
                              110 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...