Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • spawn
    Junior Member
    • Sep 2021
    • 3

    Why do some index sequences have an incorrect base?

    Hello everyone,

    I prepared a custom library using dual index TruSeq adapters for a Miseq run with a sample plexity of 3. This is the first time I performed library prep and I provided the information about indexes at the time of sample submission. For example, sample 1 has D501+D701 indexes, sample 2 has D502+D702 and so on. Today I received the data and it looks like it was already demultiplexed before they sent it to me as there were two separate files for each sample as Read1 and Read2.

    In some reads, I see that a single base is incorrect. For this particular sample, the indexes should be GGAATCTC + GGCTCTGA. They appear as expected in the first read below but in the next one, the first "G" in GGAATCTC is replaced with a "T". While the majority of reads have the correct index sequences without any errors, could someone comment why some of them are off by a base? Is this normal and does this affect index assignment and demultiplexing?

    Thank you.

    @M00677:1216:000000000-K2G3W:1:1102:15780:1709 2:N:0:GGAATCTC+GGCTCTGA
    GAGATTCCTGGGCGTCCTTAGTGCTCCGCTTAGAGTACTTCGTTTTACAGC
    +
    11>1>FFD3111A1AAAEGB1B1AFFC0AEE0111121DA1/0A//D1211

    @M00677:1216:000000000-K2G3W:1:1102:13989:1710 2:N:0:TGAATCTC+GGCTCTGA
    TAGATTCCGTTCATCTACTAGTGCTCCGCTTAGCTTACTGTTCTTTTTCCT
    +
    1111>DD31BCC1F3G3AB31B1BFDA0EEE011121BD2DB2DFFG1011
  • luc
    Senior Member
    • Dec 2010
    • 469

    #2
    You only had three samples on the run? Thus, the complexity of the index reads will be low and the quality of the index reads will be impacted due to extremely high fluorescence intensities in the lowest complexity parts. These result are expected.
    By default the Illumina demultiplexing programs will tolerate one mismatch. There are no problems to be expected due to this.

    You certainly have lost some reads due to demultiplexing problems (more than one mismatch). Potentially you could recover some of these by shortening the index information used for the demultiplexing. 16 nt of information is much more than needed to distinguish three samples.
    Last edited by luc; 11-30-2021, 09:53 PM.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM
    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      07-08-2026, 05:17 AM
    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      07-01-2026, 11:43 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Yesterday, 10:26 AM
    0 responses
    13 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-09-2026, 10:04 AM
    0 responses
    26 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-08-2026, 10:08 AM
    0 responses
    16 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-07-2026, 11:05 AM
    0 responses
    33 views
    0 reactions
    Last Post SEQadmin2  
    Working...