Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • BADE
    Member
    • Jan 2014
    • 13

    #1

    Trimmomatic dropping 100% sRNA reads

    Hi All,

    This is my first post on SEQanswers and I am hoping some help from senior members . I am analyzing sRNA single end sequencing data and using Trimmomatic for trimming adapters. The problem is that after trimming process all the reads are getting dropped. Here is the summary for one file:

    TrimmomaticSE: Started with arguments: -threads 52 -phred64 -trimlog C2.log.txt C2.fastq.gz C2.Processed ILLUMINACLIP:./Trimmomatic-0.32/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 CROP:24 MINLEN:21
    Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
    Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
    ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
    Input Reads: 39733090 Surviving: 0 (0.00%) Dropped: 39733090 (100.00%)
    TrimmomaticSE: Completed successfully
    As you see, all the trimmed reads have been dropped. I believe that this because of threshold values used - palindrome clip threshold, leading, trailing and sliding window. Should I be using palindrome clip thershold? I would really appreciate it if you can help me with this problem.

    Thanks

    BADE
  • TiborNagy
    Senior Member
    • Mar 2010
    • 329

    #2
    I guess the problem is you crop parameter. Your adaptor sequence is 34 nucleotide length, but the crop parameter is 24.

    Comment

    • mastal
      Senior Member
      • Mar 2009
      • 666

      #3
      The palindrome clip parameter will not be a problem, as you are not doing any palindrome trimming (you have SE reads, not PE, and your trimmomatic output says 'Using 0 prefix pairs').

      How long are your reads? Your CROP:24 and MINLEN:21 is probably the reason
      none of your reads are surviving.



      What Illumina version are your reads? The current Illumina versions use the -phred33 quality encoding. See

      Comment

      • BADE
        Member
        • Jan 2014
        • 13

        #4
        Hi Mastal

        Originally posted by mastal View Post
        How long are your reads? Your CROP:24 and MINLEN:21 is probably the reason
        none of your reads are surviving.
        The reads are 50nt long. I selected Minlength so that reads with length >= 21 after trimming are retained. That is because a proportion of miRNAs are of length 21nt. I chop at length 24 after trimming because sRNA longer than 24 are basically not miRNAs and not of particular interet to me. But in both cases Minlength and Crop I am assuming that steps are performed on trimmed read. Am I wrong?

        What Illumina version are your reads? The current Illumina versions use the -phred33 quality encoding.
        FastQC mentiones Illumina version 1.9 which uses phred33 as per the wiki link you sent.

        These are the results after modifying the quality encoding to phred33 and with different MinLength and Crop options:

        $ ./trimmomatic.sh
        TrimmomaticSE: Started with arguments: -threads 52 -phred33 C1.fastq.gz C1.Processed ILLUMINACLIP:./Trimmomatic-0.32/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 CROP:24 MINLEN:21
        Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
        Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
        ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
        Input Reads: 37243929 Surviving: 36503574 (98.01%) Dropped: 740355 (1.99%)
        TrimmomaticSE: Completed successfully

        TrimmomaticSE: Started with arguments: -threads 52 -phred33 C1fastq.gz C1.ProcessedDefault ILLUMINACLIP:./Trimmomatic-0.32/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
        Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
        Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
        ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
        Input Reads: 37243929 Surviving: 24107314 (64.73%) Dropped: 13136615 (35.27%)
        TrimmomaticSE: Completed successfully
        Now we have reads surviving and the number of survived reads is high with CROP:24 and MINLEN:21. Again I am assuming that both of these parameters are realted to trimmed read and not adapter?

        Best

        Bade

        Comment

        • tonybolger
          Senior Member
          • Feb 2010
          • 156

          #5
          Originally posted by BADE View Post
          FastQC mentiones Illumina version 1.9 which uses phred33 as per the wiki link you sent.
          Using phred64 on phred33 data will usually result in little or no output, since it lowers quality scores by 31 across the board, dropping them below any reasonable threshold. Since this is a common problem, the most recent version of trimmomatic auto-detects the quality score.

          Originally posted by BADE View Post
          Now we have reads surviving and the number of survived reads is high with CROP:24 and MINLEN:21. Again I am assuming that both of these parameters are realted to trimmed read and not adapter?
          CROP:24 cut the read after the 24th base, but will not cause a read to be dropped.

          MINLEN:21 will drop all reads shorter than 21 bases, but will not shorten or otherwise modify the reads.

          To answer the question in the original post, trimmomatic steps are applied in the order specified to the read (or pair if you were using pairs). The first step gets the whole read or pair, and subsequent steps get to work on the part which survived previous steps.

          Hope this helps,

          Tony.

          Comment

          • BADE
            Member
            • Jan 2014
            • 13

            #6
            Hi Tony (and All),

            Thanks for confirming. I think I am on right track than. Many thanks.

            BADE

            Comment

            • relipmoc
              Member
              • Jul 2011
              • 58

              #7
              Trimmomatic is widely accepted because it is written in Java and can be easily run on various platforms. But if you pursue simplicity and efficiency, you may try skewer which also has good performance in small RNA adapter trimming.

              For your case, you may input the following command:
              $ skewer --min 21 --max 24 -t 8 -x TruSeq3-SE.fa C2.fastq.gz

              where content of TruSeq3-SE.fa is:
              >TruSeq3_IndexedAdapter
              AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
              >TruSeq3_UniversalAdapter
              AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
              Last edited by relipmoc; 01-14-2014, 08:39 AM.

              Comment

              • newfie
                Junior Member
                • Feb 2016
                • 8

                #8
                Hi all,

                This is my first post in seqanswers. I am also working with small RNA and i found this thread more useful in understanding the different parameters used in Trimmomatic. I have just now started learning things, so i have few questions regarding the parameter used by Bade (the user who opened this thread). BADE used LEADING:3 TRAILING:3.

                Does it mean that the program cut 3 bases off the start and end of the read if it falls below the threshold quality?

                If so, why just it just needs to be 3? Is it an optimum value? Is there a rationale in choosing 3?

                When i look at my quality control report i can see the per base sequence quality drops towards the end of the read. Does it mean i have to focus only on the end of the read. not the start of the read?

                Also, what is the difference between slidingwindow and leading? Both seems one and same for me.

                Sorry if i am asking too many questions at the same time and sorry if my questions are stupid. I am just learning.

                Thanks in advance for answering

                Comment

                • mastal
                  Senior Member
                  • Mar 2009
                  • 666

                  #9
                  Hi,

                  I think you should probably read the trimmomatic manual.



                  The parameter used with LEADING: and TRAILING: refers to the base quality score, not the number of bases, it was designed to remove Ns from the 3' or 5' ends of the reads.

                  Comment

                  Latest Articles

                  Collapse

                  • SEQadmin2
                    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                    by SEQadmin2



                    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                    Despite this, “CRISPR helped turn genome editing from a specialized technique into
                    ...
                    07-31-2026, 11:01 AM
                  • SEQadmin2
                    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                    by SEQadmin2


                    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                    The systematic characterization of the human proteome has
                    ...
                    07-20-2026, 11:48 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, Today, 10:05 AM
                  0 responses
                  4 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-13-2026, 12:22 PM
                  0 responses
                  31 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-11-2026, 10:35 AM
                  0 responses
                  24 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 08-06-2026, 07:41 AM
                  0 responses
                  38 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...