Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • gwilymh
    Member
    • Dec 2011
    • 72

    #1

    Problem with Trimmomatic: will not acknowledge commands

    I am trying to use the program Trimmomatic to removed adapter sequences from an Illumina paired-end read over a computer cluster. While I can get the program to open, it will either not acknowledge the commands I enter or will return an error message. I have tried all kinds of permutations of the input commands without success. Examples of input code and error messages are below

    Code:
    java -classpath /filepath/Trimmomatic-0.32/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
    -phred33 -trimlog /Results/log.txt \
    ~/filepath/data_R1.fq ~/filepath/data_R2.fq \
    ILLUMINACLIP:/filepath/src/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
    Results: (the o/s seems to find and execute the software, but is not feeding in the command; I get the same result if I use the java -jar <path to trimmomatic jar> option for executing Trimmomatic)
    TrimmomaticPE [-threads <threads>] [-phred33|-phred64] [-trimlog <trimLogFile>] [-basein <inputBase> | <inputFile1> <inputFile2>] [-baseout <outputBase> | <outputFile1P> <outputFile1U> <outputFile2P> <outputFile2U>] <trimmer1>...


    Code: (If I add in the command PE immediately before all other commands, the program executes and can find the fasta file containing the adapter sequences, but then searches for and cannot fund a file called 'PE')
    java -classpath /filepath/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
    PE -phred33 -trimlog /Results/log.txt \
    ~/refs/lec12/data_R1.fq ~/refs/lec12/data_R2.fq \
    ILLUMINACLIP:/filepath/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
    Results: (Programs rus and finds the fasta file of adapter sequences, but then fails to execute. Why is it looking for a PE file?)
    TrimmomaticPE: Started with arguments: PE -phred33 -trimlog /Results/log.txt /filepath/data_R1.fq /filepath/data_R2.fq ILLUMINACLIP:/filepath/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:true
    Multiple cores found: Using 12 threads
    Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
    Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
    Using Long Clipping Sequence: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT'
    Using Long Clipping Sequence: 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
    Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
    ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
    Exception in thread "main" java.io.FileNotFoundException: PE (No such file or directory)
    at java.io.FileInputStream.open(Native Method)
    at java.io.FileInputStream.<init>(FileInputStream.java:146)
    at org.usadellab.trimmomatic.fastq.FastqParser.parse(FastqParser.java:127)
    at org.usadellab.trimmomatic.TrimmomaticPE.process(TrimmomaticPE.java:251)
    at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:498)
    at org.usadellab.trimmomatic.TrimmomaticPE.main(TrimmomaticPE.java:506)
    Last edited by gwilymh; 07-18-2014, 10:08 AM.
  • blakeoft
    Member
    • Oct 2013
    • 79

    #2
    Code:
    java -classpath /filepath/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
    [B]PE[/B] -phred33 -trimlog /Results/log.txt \
    ~/refs/lec12/data_R1.fq ~/refs/lec12/data_R2.fq \
    ILLUMINACLIP:/filepath/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
    That PE that's floating around on the second line doesn't need to be there. I think you only put it there when you do the "java -jar" version of running trimmomatic. Can you tell me what happens when you run:

    Code:
    java -classpath /filepath/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
    -phred33 -trimlog /Results/log.txt \
    ~/refs/lec12/data_R1.fq ~/refs/lec12/data_R2.fq \
    ILLUMINACLIP:/filepath/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
    I'm also not sure about the "true" part at the very end of the code. The documentation doesn't seem to mention any boolean arguments for the ILLUMINACLIP option.

    Edit: I misread your original post, so most of what I said will seem stupid. However, I still don't see the "true" tidbit in the documentation. Can you try taking that out?

    Edit2: I just found the manual. It doesn't give an example of using the keepBothReads option for ILLUMINACLIP, but it just says specify 'true'. That is, in single quotes. Try changing that around by using single quotes or no quotes instead of double quotes.

    Edit3: One last thing! I looked at my scripts and realized that I have output files specified, but you don't. Try adding those too. Sorry for all of the suggestions. Let me know if you get any other errors or if some of my suggestions work. Try

    Code:
    java -classpath /filepath/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
    -phred33 -trimlog /Results/log.txt \
    ~/refs/lec12/data_R1.fq ~/refs/lec12/data_R2.fq \
    ~/refs/lec12/data_R1_paired.fq ~/refs/lec12/data_R1_unpaired.fq ~/refs/lec12/data_R2_paired.fq ~/refs/lec12/data_R2_unpaired.fq \
    ILLUMINACLIP:/filepath/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:true
    and maybe try it with single quotes around true.
    Last edited by blakeoft; 07-18-2014, 12:29 PM.

    Comment

    • gwilymh
      Member
      • Dec 2011
      • 72

      #3
      Thank you blakeoft. I dropped the PE flag and added individual file names for each output file and the program executed properly.

      NB: I also tried using the -baseout <outputBase> flag rather than a list of four files, and the program would open but not execute any commands

      Comment

      • tonybolger
        Senior Member
        • Feb 2010
        • 156

        #4
        Originally posted by gwilymh View Post
        Thank you blakeoft. I dropped the PE flag and added individual file names for each output file and the program executed properly.

        NB: I also tried using the -baseout <outputBase> flag rather than a list of four files, and the program would open but not execute any commands
        Glad you have already solved it with blakeoft's help.

        As you see for PE mode, 6 files need to be given before the list of trimming steps (unless you use -basein/-baseout which replace 2 / 4 files respectively).

        Tony.

        Comment

        • dineshsanka
          Junior Member
          • Apr 2017
          • 5

          #5
          Help me with trimmometic

          Hi there,
          I am a beginner with respect to WGS analysis. Excuse me for any mistake.

          here is the command i have used

          java -jar /Users/apple/Downloads/Trimmomatic-0.36/trimmomatic-0.36.jar PE -phred33 -trimlog /Users/apple/Downloads/Trimmomatic-0.36/SL.trimlog -basein /Users/apple/Downloads/Trimmomatic-0.36/SL_R1.fastq /Users/apple/Downloads/Trimmomatic-0.36/SL_R2.fastq -baseout /Users/apple/Downloads/Trimmomatic-0.36/SL_R1_trimmed_1P.fastq /Users/apple/Downloads/Trimmomatic-0.36/SL_R1_trimmed_1U.fastq /Users/apple/Downloads/Trimmomatic-0.36/SL_R1_trimmed_2P.fastq /Users/apple/Downloads/Trimmomatic-0.36/SL_R1_trimmed_2U.fastq /Users/apple/Downloads/Trimmomatic-0.36/adapters/TruSeq2-SE.fa LEADING:30 TRAILING:25 SLINGWINDOW:20 MINLENGTH:100

          I m getting error like this unable to determine input files

          Please help me.

          Dinesh
          Attached Files

          Comment

          • mastal
            Senior Member
            • Mar 2009
            • 666

            #6
            Don't use -basein and -baseout if you give the full names of the input and output files.

            You have a typo in the rest of the command, it should be SLIDINGWINDOW not SLINGWINDOW.

            You should probably not put your input and output in the same directory as the trimmomatic program files.

            Comment

            • dineshsanka
              Junior Member
              • Apr 2017
              • 5

              #7
              Hi there,
              Thanks a lot. I am still getting error even after changing the output directory, correcting the typo in command and removing base in and base out.

              java -jar /Users/apple/Downloads/Trimmomatic-0.36/trimmomatic-0.36.jar PE -phred33 -trimlog /Users/apple/Downloads/Trimmomatic-0.36/SL.trimlog /Users/apple/Downloads/Trimmomatic-0.36/SL_R1.fastq /Users/apple/Downloads/SL_R2.fastq /Users/apple/Downloads/SL_R1_trimmed_1P.fastq /Users/apple/Downloads/SL_R1_trimmed_1U.fastq /Users/apple/Downloads/SL_R1_trimmed_2P.fastq /Users/apple/Downloads/Trimmomatic-0.36/adapters/NexteraPE-PE.fa LEADING:30 TRAILING:25 SLIDINGWINDOW:20 MINLENGTH:100

              Regards,
              Dinesh
              Attached Files

              Comment

              • mastal
                Senior Member
                • Mar 2009
                • 666

                #8
                More syntax errors.

                It appears that you only have names for 3 of the 4 output files, you are missing a name for the 2U output file. The command that uses the adapter fasta sequences is ILLUMINACLIP,
                see the trimmomatic web page for the parameters to use with it.

                Comment

                • dineshsanka
                  Junior Member
                  • Apr 2017
                  • 5

                  #9
                  Unknown trimmer

                  Hi there,
                  Thanks for your reply.
                  java -jar /Users/apple/Downloads/Trimmomatic-0.36/trimmomatic-0.36.jar PE -phred33 -trimlog /Users/apple/Downloads/Trimmomatic-0.36/SL.trimlog /Users/apple/Downloads/Trimmomatic-0.36/SL_R1.fastq /Users/apple/Downloads/SL_R2.fastq /Users/apple/Downloads/SL_R1_trimmed_1P.fastq /Users/apple/Downloads/SL_R1_trimmed_1U.fastq /Users/apple/Downloads/SL_R1_trimmed_2P.fastq ILLUMINACLIP: /Users/apple/Downloads/Trimmomatic-0.36/adapters/TruSeq3-PE.fa2:30:10 LEADING:30 TRAILING:25 SLIDINGWINDOW:20 MINLENGTH:100

                  I tried with all the adaptor sequences
                  NexteraPE-PE.fa
                  TruSeq2-PE.fa
                  TruSeq2-SE.fa
                  TruSeq3-PE-2.fa
                  TruSeq3-PE.fa
                  TruSeq3-SE.fa

                  I am getting Exception in thread "main" java.lang.RuntimeException: Unknown trimmer: /Users/apple/Downloads/Trimmomatic-0.36/adapters/TruSeq3-PE.fa2
                  Attached Files

                  Comment

                  • mastal
                    Senior Member
                    • Mar 2009
                    • 666

                    #10
                    The error message suggests that there is still something not quite right with the syntax.

                    It looks like you have not added a name for the 2U output file.

                    I don't think there is anything wrong with the adapter files, but you need to use the one that has the right adapters for your data. You need to find out which library prep kit was used to generate the data.

                    You are also missing a colon between the name of the adapter fasta file and the trimming parameters 2:30:10 - that is probably what the error message is complaining about.
                    Last edited by mastal; 04-22-2017, 12:51 PM.

                    Comment

                    • dineshsanka
                      Junior Member
                      • Apr 2017
                      • 5

                      #11
                      Looks Job done

                      Hi there,
                      I followed your suggestions. Looks like job is done. Thanks
                      The command used
                      java -jar /Users/apple/Downloads/Trimmomatic-0.36/trimmomatic-0.36.jar PE -phred33 -trimlog /Users/apple/Downloads/Trimmomatic-0.36/SL.trimlog /Users/apple/Downloads/Trimmomatic-0.36/SL_R1.fastq /Users/apple/Downloads/Trimmomatic-0.36/SL_R2.fastq /Users/apple/Downloads/SL_R1_trimmed_1P.fastq /Users/apple/Downloads/SL_R1_trimmed_1U.fastq /Users/apple/Downloads/SL_R1_trimmed_2P.fastq /Users/apple/Downloads/SL_R1_trimmed_2U.fastq ILLUMINACLIP:/Users/apple/Downloads/Trimmomatic-0.36/adapters/TruSeq2-PE.fa:2:30:10 LEADING:30 TRAILING:25 SLIDINGWINDOW:4:20 MINLEN:100
                      Attached Files

                      Comment

                      Latest Articles

                      Collapse

                      • SEQadmin2
                        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                        by SEQadmin2



                        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                        Despite this, “CRISPR helped turn genome editing from a specialized technique into
                        ...
                        07-31-2026, 11:01 AM
                      • SEQadmin2
                        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                        by SEQadmin2


                        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                        The systematic characterization of the human proteome has
                        ...
                        07-20-2026, 11:48 AM
                      • SEQadmin2
                        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                        by SEQadmin2



                        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                        ...
                        07-09-2026, 11:10 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, Yesterday, 07:41 AM
                      0 responses
                      12 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-03-2026, 10:13 AM
                      0 responses
                      25 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-31-2026, 02:55 AM
                      0 responses
                      38 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 07-24-2026, 12:17 PM
                      0 responses
                      25 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...