yeah, that's what the line with grep is supposed to check-whether that string abyss complains about is in there.
-
-
how long should that take..hours or just minutes...mine is already bussy for an hour...Comment
-
Well, for a 1.2 gig file (compressed), my machine needed about 3 minutes (transfering it on a gigabit network) for doing the 'gzip -cd | grep' stanca.Comment
-
I don't get any output at all, if I use the line:
gzip -cd s_7_sequence.fastq.gz | grep "Ms_7_sequence.txt"
But I also already thought that there wouldn't be a line with "Ms_7_sequence.txt"....Comment
-
Yes, no output is what you would get if there was no 'Ms_7_sequence.txt' in there.
Curiouser and curiouser - have you tried passing the un-gziped file (gzip -d name.fastq.gz) to AbySS?Comment
-
That is weird!!! the last time I tried it din't work and now it is reading the file! I'll cross my fingers and hope for the best. Do you have any idea how long it could take? I read somewhere that it can take between 3 and 10 hours...Comment
-
that depends.
What exactly are you trying to assemble, how many reads do you have, etc?.
Generally, assembly can take a long (long) time.Comment
-
Hi all, I'm new here and have a problem.
Maybe its not right place to write but I can not write new post.
I'm using the ABySS for 36bp sequences and now will use the trans-ABySS.
I used command: for k in {18..35}; do ABYSS <file to analyze> -o <where save the file>-k@$k.fa;
My input was file with contigs (after format: fastanrdb) with FASTA extenstion.
I got from ABYSS analysis files. They looks like (examples):
>0 31 117
AGACTTCCCAACATTTATTGCTCTTTCTCTT
>1 35 79
ATGAATTCTATTGGAGATTGTACATTAGTTATGTA
>2 27 60
ATGAATTCTATTGGAGAATGTACATTA
>3 44 666
TTTTTATTTTTGTTCAGAAGGAGTCGTTGGTTGTTCTTCATTTT
>4 111 1332
GATGGTGTAATGAACTCAACAATATCATCTCTTATTACTATATCTGACCGTGCTTATGTAACATTAACTAATTACCAAGGATTGTATAGATTAAATTGTGACCAGAAAACT
>5 18 31
GGAGTGTCGATGCTTGAA
>6 38 213
GCAAATTCTGTTACAATTGATATTTCTCCTTCTGTATA
I have problem with next step of analysis-the trans-Abyss
In manual guide I read that the trans abyss needs specific folder structure.
I dont know what does it means, because I put my results from abyss (in fasta) in folders: LIB0001/kn(15-35)/...fasta (from abyss)
I dont know what is next?
sorry for so complicates question but I am so sad sitting, reading and nothing.....Comment
-
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...07-31-2026, 11:01 AM -
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...07-20-2026, 11:48 AM -
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...07-09-2026, 11:10 AM
Comment