MiSeq Index Primer Sequence

[krispy]

Hi all,

I am looking for the exact sequence for the default MiSeq Index Primer. Can anyone help me to check if this is the correct one?

5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

and probably provide me if there is any reliable source where Illumina confirms this is the correct sequence?

Thank you very much.
Merry Christmas.

[gringer]

You mean these sequences?

http://supportres.illumina.com/documents/myillumina/6378de81-c0cc-47d0-9281-724878bb1c30/2012-09-18_illuminacustomersequenceletter.pdf

[krispy]

Thanks for the reply.

I actually got the sequence from the customer letter too (here in: oligonucleotide sequences for the multiplexing sample prep oligo only kit - multiplexing index read sequencing primer).

but may I know is there somewhere stated that this is also the MiSeq Index Primer that comes together with the kit? I wish to synthesize the same primer but load it as custom index primer in different well, I am kinda sure the sequence I got above will work as a custom index primer too even it's not the same with the default one (because it will be run as custom anyway), but I was given a "task" to find out the exact MiSeq default index primer.

[gringer]

MiSeq uses TruSeq and Nextera kits, so I expect that the TruSeq/Nextera primer sequences used in that document are the correct ones. You would probably need to contact Illumina to confirm that ([email protected], or [email protected]).