Header Leaderboard Ad

Collapse

Can Pindel applied to SOLiD data?

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Can Pindel applied to SOLiD data?

    Dear All
    Just want to know if anyone has relevant experiences in calling INDELS using Pindel on SOLiD data. We used Pindel on Illumina samples (bam files) with good outcome but now when we moved to SOLid data (bam files, already mapped to reference genome), all I got are empty output files

    I have very little experience with SOLiD data, can anyone share with me your experience in applying Pindel to SOLiD data? What procedure did u go through to get the results?
    Thanks

  • #2
    Originally posted by slowsmile View Post
    Dear All
    Just want to know if anyone has relevant experiences in calling INDELS using Pindel on SOLiD data. We used Pindel on Illumina samples (bam files) with good outcome but now when we moved to SOLid data (bam files, already mapped to reference genome), all I got are empty output files

    I have very little experience with SOLiD data, can anyone share with me your experience in applying Pindel to SOLiD data? What procedure did u go through to get the results?
    Thanks
    Pindel expects the read orientation as in Illumina paired-end. There is one sam2pindel program to handle SOLiD data but performance is not guaranteed to be optimal.

    Comment


    • #3
      Thanks Kaiye for your suggestion

      However, I am still unable to convert the SoLID bam files into Pindel compatible format with the sam2pindel function. The reads in my SoLID bam file looks like this:

      475_151_1990 0 chr1 10108 38 72M3H * 0 0 CAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAACCCTNNCCCTAACC [email protected]@>@[email protected][email protected]@@[email protected][email protected]@??>>>=<<=>>>==>>>>===>>>>==>>>>==>5440'-7710576888 BD:Z:SSTSYVXWVVVRTSRSTQSRQRSPSRQRSPSRQRSPSRQRSPPSRQRSPSRQRSPRQPRSPSRSTUTWSRST PG:Z:MarkDuplicates RG:Z:ugc_509_10_10 NH:i:50 BI:Z:VVUVYWZXVWVSUUTVVTWUTUVSWTTUVTWTTVVTVTSUUSSVTSUUSVTSUUSVTRSSRTWYYYWZUTVV CM:i:1 NM:i:0 CQ:Z:@@>@@@@@@@@@@@@@@@@@@@[email protected][email protected]>@;8=>;?/2/66622/2<836/2222;//<82</6/82//[email protected]>8/ CS:Z:T210100230100230100230100230100230100230100023010023010023010022010023010023
      407_312_991 0 chr1 10140 2 39M36H * 0 0 ACCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAAC [email protected][email protected]@@@@[email protected]@[email protected]@[email protected][email protected]>>><<==>>==>>2+ BD:Z:SSTQYXVWXTSUSRSTQTRQRSPSRQRSPSRQRSPTSRS PG:Z:MarkDuplicates RG:Z:ugc_509_10_10 NH:i:50 BI:Z:VVVTZXWYXUTVSTVVTWUTVUTVUSVUTWUSVVTWUTV CM:i:0 NM:i:0 CQ:Z:@@@@@@@@@@@[email protected]@66>[email protected]@/@<[email protected]@8<@/[email protected]/62/28/2/////<68/;//62////////;2///2/88= CS:Z:T310023010002301002301002301002301002301100300103330103330300133112133002133
      I tried "samtools view -h input.bam | ./sam2pindel - output.pindel 250 sample 0"
      and the output "output.pindel" contain 0 reads somehow

      I even tried the newer version of sam2pindel with the "Illumina-PairEnd" at the end, it still generates 0 reads in the output file

      Any suggestion?
      Thank you

      Comment

      Latest Articles

      Collapse

      • seqadmin
        A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
        by seqadmin


        ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

        01-24-2023, 01:19 PM
      • seqadmin
        Introduction to Single-Cell Sequencing
        by seqadmin
        Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

        The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
        ...
        01-09-2023, 03:10 PM

      ad_right_rmr

      Collapse
      Working...
      X