Can Pindel applied to SOLiD data?

[slowsmile]

Dear All
Just want to know if anyone has relevant experiences in calling INDELS using Pindel on SOLiD data. We used Pindel on Illumina samples (bam files) with good outcome but now when we moved to SOLid data (bam files, already mapped to reference genome), all I got are empty output files

I have very little experience with SOLiD data, can anyone share with me your experience in applying Pindel to SOLiD data? What procedure did u go through to get the results?
Thanks

[KaiYe]

Dear All
Just want to know if anyone has relevant experiences in calling INDELS using Pindel on SOLiD data. We used Pindel on Illumina samples (bam files) with good outcome but now when we moved to SOLid data (bam files, already mapped to reference genome), all I got are empty output files

I have very little experience with SOLiD data, can anyone share with me your experience in applying Pindel to SOLiD data? What procedure did u go through to get the results?
Thanks

Pindel expects the read orientation as in Illumina paired-end. There is one sam2pindel program to handle SOLiD data but performance is not guaranteed to be optimal.

[slowsmile]

Thanks Kaiye for your suggestion

However, I am still unable to convert the SoLID bam files into Pindel compatible format with the sam2pindel function. The reads in my SoLID bam file looks like this:

475_151_1990 0 chr1 10108 38 72M3H * 0 0 CAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAACCCTNNCCCTAACC AAA@@>@AAA@??@@@??@?@@??>>>=<<=>>>==>>>>===>>>>==>>>>==>5440'-7710576888 BD:Z:SSTSYVXWVVVRTSRSTQSRQRSPSRQRSPSRQRSPSRQRSPPSRQRSPSRQRSPRQPRSPSRSTUTWSRST PG:Z:MarkDuplicates RG:Z:ugc_509_10_10 NH:i:50 BI:Z:VVUVYWZXVWVSUUTVVTWUTUVSWTTUVTWTTVVTVTSUUSSVTSUUSVTSUUSVTRSSRTWYYYWZUTVV CM:i:1 NM:i:0 CQ:Z:@@>@@@@@@@@@@@@@@@@@@@?@??6@>@;8=>;?/2/66622/2<836/2222;//<82</6/82//22@>8/ CS:Z:T210100230100230100230100230100230100230100023010023010023010022010023010023
407_312_991 0 chr1 10140 2 39M36H * 0 0 ACCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAAC AA@?A?@A@@@@?@@??@@?@??@>>><<==>>==>>2+ BD:Z:SSTQYXVWXTSUSRSTQTRQRSPSRQRSPSRQRSPTSRS PG:Z:MarkDuplicates RG:Z:ugc_509_10_10 NH:i:50 BI:Z:VVVTZXWYXUTVSTVVTWUTVUTVUSVUTWUSVVTWUTV CM:i:0 NM:i:0 CQ:Z:@@@@@@@@@@@2=68@@66>2@@/@<8@@8<@/2@/62/28/2/////<68/;//62////////;2///2/88= CS:Z:T310023010002301002301002301002301002301100300103330103330300133112133002133

I tried "samtools view -h input.bam | ./sam2pindel - output.pindel 250 sample 0"
and the output "output.pindel" contain 0 reads somehow

I even tried the newer version of sam2pindel with the "Illumina-PairEnd" at the end, it still generates 0 reads in the output file

Any suggestion?
Thank you