Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • jordi
    Member
    • Apr 2009
    • 49

    454 fasta files

    Hi all,
    I'm a bit confused with the 454 fasta output files after a sequencing run. Below you have an example what I got. According to that my 454 knowledge, capital letters were those with the higher quality scores, i.e. lowercase bases where those trimmed or filtered. But what about those lowercase bases with high quality scores?? (for instance those in bold).
    Finally I tried to perform an assembly process from the second fasta file, bu I suspect lost a lot of information.
    What do you think?
    Thanks a lot.
    >FF56QEU12HGEH6
    tcagGGGGTAGGCAACCCAAAACACTCAAAGAGCCACTTGGACCC
    GTTTCCCACCGAAAACAAACACTGGGAGCCTTTTGGATCTAAAATGAAGATATTA
    TTATTATTATTATTATTTATTAAATTTCatgccgccctattccggaaactcaggg
    cgataacactgcagatatccttttttaccttaangtgtgtgtgtgtgtgtgtctt
    tgtgttgtatatataaataaaggtaaaaaggatatatgcagtgttatcttctatt
    tggtatgtacgtaaaacggg

    >uaccno=FF56QEU12HGEH6
    GGGGTAGGCAACCCAAAACACTCAAAGAGCCACTTGGACCCGTTTCCCACCGAAAACAAACACTGGGAGCCTTTTGGATCTAAAATGAAGATATTATTATTATTATTATTAT
    TTATTAAATTTC

    >FF56QEU12HGEH6
    32 32 32 32 31 31 31 31 32 32 17 17 36 33 33 30 30 30 20 20 20 20 29 22 30 33 32 32 33 33 37 37 40 36 36 36 37 37 37 32 32 32 28 28 28 32 31 30 29 13 13 13 27 19 15 23 13 13 13 13 15 9 9 9 15 11 24 26 23 23 23 26 18 26 26 22 23 23 23 18 18 18 27 31 30 30 30 30 32 32 32 32 32 32 32 32 32 32 32 32 32 32 32 32 30 30 30 30 28 28 28 28 28 24 25 13 13 13 13 11 11 13 16 25 13 13 13 21 21 28 30 31 31 30 17 17 17 30 32 32 30 30 30 30 30 30 17 17 17 26 26 29 15 15 17 22 17 21 26 26 26 26 26 26 26 30 28 23 23 23 23 23 23 13 13 13 13 13 13 13 13 13 13 16 9 9 23 23 0 24 26 29 30 30 30 30 30 29 28 28 28 26 26 24 21 15 15 15 12 12 11 17 11 20 20 11 11 11 11 11 20 20 17 17 11 11 11 11 11 11 11 17 17 17 11 11 11 9 9 11 11 7 16 15 15 15 11 11 11 11 11 16 15 15 18 16 15 16 11 11 11 11 16 13 13 13 16 16 11 11 13 13 18 22 22 22 22 21 21 21 21 22 22 22 22

Latest Articles

Collapse

  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    07-08-2026, 05:17 AM
  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    07-01-2026, 11:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Yesterday, 10:26 AM
0 responses
12 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-09-2026, 10:04 AM
0 responses
25 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-08-2026, 10:08 AM
0 responses
16 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-07-2026, 11:05 AM
0 responses
33 views
0 reactions
Last Post SEQadmin2  
Working...