Header Leaderboard Ad

Collapse

454 fasta files

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • 454 fasta files

    Hi all,
    I'm a bit confused with the 454 fasta output files after a sequencing run. Below you have an example what I got. According to that my 454 knowledge, capital letters were those with the higher quality scores, i.e. lowercase bases where those trimmed or filtered. But what about those lowercase bases with high quality scores?? (for instance those in bold).
    Finally I tried to perform an assembly process from the second fasta file, bu I suspect lost a lot of information.
    What do you think?
    Thanks a lot.
    >FF56QEU12HGEH6
    tcagGGGGTAGGCAACCCAAAACACTCAAAGAGCCACTTGGACCC
    GTTTCCCACCGAAAACAAACACTGGGAGCCTTTTGGATCTAAAATGAAGATATTA
    TTATTATTATTATTATTTATTAAATTTCatgccgccctattccggaaactcaggg
    cgataacactgcagatatccttttttaccttaangtgtgtgtgtgtgtgtgtctt
    tgtgttgtatatataaataaaggtaaaaaggatatatgcagtgttatcttctatt
    tggtatgtacgtaaaacggg

    >uaccno=FF56QEU12HGEH6
    GGGGTAGGCAACCCAAAACACTCAAAGAGCCACTTGGACCCGTTTCCCACCGAAAACAAACACTGGGAGCCTTTTGGATCTAAAATGAAGATATTATTATTATTATTATTAT
    TTATTAAATTTC

    >FF56QEU12HGEH6
    32 32 32 32 31 31 31 31 32 32 17 17 36 33 33 30 30 30 20 20 20 20 29 22 30 33 32 32 33 33 37 37 40 36 36 36 37 37 37 32 32 32 28 28 28 32 31 30 29 13 13 13 27 19 15 23 13 13 13 13 15 9 9 9 15 11 24 26 23 23 23 26 18 26 26 22 23 23 23 18 18 18 27 31 30 30 30 30 32 32 32 32 32 32 32 32 32 32 32 32 32 32 32 32 30 30 30 30 28 28 28 28 28 24 25 13 13 13 13 11 11 13 16 25 13 13 13 21 21 28 30 31 31 30 17 17 17 30 32 32 30 30 30 30 30 30 17 17 17 26 26 29 15 15 17 22 17 21 26 26 26 26 26 26 26 30 28 23 23 23 23 23 23 13 13 13 13 13 13 13 13 13 13 16 9 9 23 23 0 24 26 29 30 30 30 30 30 29 28 28 28 26 26 24 21 15 15 15 12 12 11 17 11 20 20 11 11 11 11 11 20 20 17 17 11 11 11 11 11 11 11 17 17 17 11 11 11 9 9 11 11 7 16 15 15 15 11 11 11 11 11 16 15 15 18 16 15 16 11 11 11 11 16 13 13 13 16 16 11 11 13 13 18 22 22 22 22 21 21 21 21 22 22 22 22
Working...
X