Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • jorjial
    Junior Member
    • Mar 2010
    • 7

    #1

    Bioscope - Format mapping

    Hi all,
    I'm using Bioscope for mapping some resequencing samples, but I don't know which is the meaning of all the fields in the csfasta.ma. An example:

    >83_896_1349_F3,1_70.024.0.0):q29

    I know that...
    - "83_896_1349_F3": fragment reference.
    - "1_70.0": chromosome_position.

    but I don't know which is the meaning of the numbers in brackets (I think the second number is the number of mismatches) and the "q value".

    Can anyone help me?

    Thanks a lot,

    Regards

    J.
  • jlli
    Member
    • Jun 2008
    • 19

    #2
    (24.0.0): The first number is the number of color bases of the read are matched to the reference. In this case is 24; the second number is number of mismathces; and the third one is offsets. In this case, the read matches to the reference at the 1st color (alignment offset is 0)

    q29: an alignment quality value for the mapped read.

    Comment

    • jorjial
      Junior Member
      • Mar 2010
      • 7

      #3
      Thank you very much jlli!

      Regards,

      J.

      Comment

      • aguffanti
        Member
        • Dec 2008
        • 29

        #4
        Originally posted by jorjial View Post
        Hi all,
        I'm using Bioscope for mapping some resequencing samples, but I don't know which is the meaning of all the fields in the csfasta.ma. An example:

        >83_896_1349_F3,1_70.024.0.0):q29

        I know that...
        - "83_896_1349_F3": fragment reference.
        - "1_70.0": chromosome_position.

        but I don't know which is the meaning of the numbers in brackets (I think the second number is the number of mismatches) and the "q value".

        Can anyone help me?

        Thanks a lot,

        Regards

        J.
        Hi. Use Bioscope maToGff3 conversion and then use a parsing script - in attach a script I do use for miRNA analysis

        HTH,

        Alessandro

        --

        #!/usr/bin/perl

        $|=1;

        my $infile = $ARGV[0] or die ('I need an infile with miRNA matches in gff3 coordinates');
        chomp $infile;
        my $outfasta = $infile.".smallrna.fasta";

        my $zero = $infile.".smallrna.0";
        my $one = $infile.".smallrna.1";
        my $two = $infile.".smallrna.2";

        %chr_convert = (
        "1" => "chr10",
        "2" => "chr11",
        "3" => "chr12",
        "4" => "chr13",
        "5" => "chr14",
        "6" => "chr15",
        "7" => "chr16",
        "8" => "chr17",
        "9" => "chr18",
        "10" => "chr19",
        "11" => "chr1",
        "12" => "chr20",
        "13" => "chr21",
        "14" => "chr22",
        "15" => "chr2",
        "16" => "chr3",
        "17" => "chr4",
        "18" => "chr5",
        "19" => "chr6",
        "20" => "chr7",
        "21" => "chr8",
        "22" => "chr9",
        "23" => "chrM",
        "24" => "chrX",
        "25" => "chrY",
        );

        open (ZERO,">$zero") or die ("Could not open $zero for writing");
        open (ONE,">$one") or die ("Could not open $zero for writing");
        open (TWO,">$two") or die ("Could not open $zero for writing");
        open (INFILE,"<$infile") or die ("Could not open $infile for reading");
        while ($line=<INFILE>) {
        ($line =~ /#/) && next;
        my @fields = split (/\t/,$line);
        my $mismatches;
        my $classifier;
        my $ms_type = "WT";
        my $pre_chr = $fields[0];
        my $chr = $chr_convert{$pre_chr};
        $start = $fields[3];
        $end = $fields[4];
        $strand = $fields[6];
        $bigstr=$fields[8];
        if ($bigstr =~ /\;s\=(.+)\;/) {
        $mismatches = $1;
        if ($mismatches =~ /[g|r]/mg) { $ms_type = "VAR" } else { $ms_type = "MM" }
        }
        if ($bigstr =~ /\;u\=(\d.{0,})\n/) { $classifier = $1; }
        my @bigstr_fields = split (/\;/,$bigstr);
        my $read_id=$bigstr_fields[0];
        $read_id=~s/aID\=//;
        my $seq=$bigstr_fields[2];
        $seq=~s/b\=//;
        if ($classifier =~ /^1/) {
        print ZERO "$read_id\t$chr\t$start\t$end\t$strand\t$seq\t$classifier\t$ms_type\t$mismatches\n";
        } elsif ($classifier eq "0,1") {
        print ONE "$read_id\t$chr\t$start\t$end\t$strand\t$seq\t$classifier\t$ms_type\t$mismatches\n";
        } else {
        print TWO "$read_id\t$chr\t$start\t$end\t$strand\t$seq\t$classifier\t$ms_type\t$mismatches\n";
        }
        next;
        }
        close (INFILE);
        close (ZERO);
        close (ONE);
        close (TWO);

        Comment

        • westerman
          Rick Westerman
          • Jun 2008
          • 1104

          #5
          Not to be too picky about your code since Perl has "more than one way to do things" but the following lines are incorrect since they will report a incorrect file name in the 'die'.

          open (ONE,">$one") or die ("Could not open $zero for writing");
          open (TWO,">$two") or die ("Could not open $zero for writing");

          Also while I am at it, modern perl practice recommends the 3-argument open. E.g.,

          open (ONE, '>', $one) or die ("Cound not open $one for writing");

          Comment

          • rahilsethi
            Member
            • May 2010
            • 22

            #6
            Total Mapped region of reference?

            Hi everyone,

            I'm sorry for the deviation from the main question of this thread. Since I was not able to find how to start a new thread, this was the thread that I could find that is related most to my question.

            Once mapping is done how will I find the total region of reference mapped? I know that the mapping.stats file gives you Megabases of coverage but that is the sum of length of all reads mapped to reference. So, in case of overlapped mapping the megabases of coverage will be more than the total region of reference mapped. For example:

            suppose there are two reads that were mapped to reference as shown below

            Read1 AAATTTGCTGC
            Read2 GCTGCATTCCA

            Reference: AAATTTGCTGCATTCCATTA

            The mapping will be:

            Read2 GCTGCATTCCA
            Read1 AAATTTGCTGC
            Reference AAATTTGCTGCATTCCATTA

            Here Megabases of coverage will be = 11 x 2 = 22 bases
            but total region (length) of reference mapped = 17 bases

            Now where will I get total region of reference mapped from the Mapping run of Bioscope?

            Comment

            • drio
              Senior Member
              • Oct 2008
              • 323

              #7
              1. You can click in the New post link:



              2. I don't think you are going to get that information from the BS output.
              You'll have to process the mapped data (BAM or BS text/internal format) to
              answer that question.
              -drd

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                New Genomics Technologies Take Aim at Long-Standing Limits
                by SEQadmin2


                Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

                We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
                ...
                Yesterday, 10:25 AM
              • SEQadmin2
                How Immunogenomics Decodes Immunity’s Genetic Blueprint
                by SEQadmin2




                The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

                This convergence of genetics, immunology, and computation...
                09-01-2026, 05:41 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, Today, 09:51 AM
              0 responses
              10 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 09-25-2026, 09:06 AM
              0 responses
              32 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 09-23-2026, 11:05 AM
              0 responses
              27 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 09-18-2026, 11:37 AM
              1 response
              48 views
              0 reactions
              Last Post pekgio
              by pekgio
               
              Working...