Bioscope - Format mapping

[jorjial]

Hi all,
I'm using Bioscope for mapping some resequencing samples, but I don't know which is the meaning of all the fields in the csfasta.ma. An example:

>83_896_1349_F3,1_70.024.0.0):q29

I know that...
- "83_896_1349_F3": fragment reference.
- "1_70.0": chromosome_position.

but I don't know which is the meaning of the numbers in brackets (I think the second number is the number of mismatches) and the "q value".

Can anyone help me?

Thanks a lot,

Regards

J.

[jlli]

(24.0.0): The first number is the number of color bases of the read are matched to the reference. In this case is 24; the second number is number of mismathces; and the third one is offsets. In this case, the read matches to the reference at the 1st color (alignment offset is 0)

q29: an alignment quality value for the mapped read.

[jorjial]

Thank you very much jlli!

Regards,

J.

[aguffanti]

Hi all,
I'm using Bioscope for mapping some resequencing samples, but I don't know which is the meaning of all the fields in the csfasta.ma. An example:

>83_896_1349_F3,1_70.024.0.0):q29

I know that...
- "83_896_1349_F3": fragment reference.
- "1_70.0": chromosome_position.

but I don't know which is the meaning of the numbers in brackets (I think the second number is the number of mismatches) and the "q value".

Can anyone help me?

Thanks a lot,

Regards

J.

Hi. Use Bioscope maToGff3 conversion and then use a parsing script - in attach a script I do use for miRNA analysis

HTH,

Alessandro

--

#!/usr/bin/perl

$|=1;

my $infile = $ARGV[0] or die ('I need an infile with miRNA matches in gff3 coordinates');
chomp $infile;
my $outfasta = $infile.".smallrna.fasta";

my $zero = $infile.".smallrna.0";
my $one = $infile.".smallrna.1";
my $two = $infile.".smallrna.2";

%chr_convert = (
"1" => "chr10",
"2" => "chr11",
"3" => "chr12",
"4" => "chr13",
"5" => "chr14",
"6" => "chr15",
"7" => "chr16",
"8" => "chr17",
"9" => "chr18",
"10" => "chr19",
"11" => "chr1",
"12" => "chr20",
"13" => "chr21",
"14" => "chr22",
"15" => "chr2",
"16" => "chr3",
"17" => "chr4",
"18" => "chr5",
"19" => "chr6",
"20" => "chr7",
"21" => "chr8",
"22" => "chr9",
"23" => "chrM",
"24" => "chrX",
"25" => "chrY",
);

open (ZERO,">$zero") or die ("Could not open $zero for writing");
open (ONE,">$one") or die ("Could not open $zero for writing");
open (TWO,">$two") or die ("Could not open $zero for writing");
open (INFILE,"<$infile") or die ("Could not open $infile for reading");
while ($line=<INFILE>) {
($line =~ /#/) && next;
my @fields = split (/\t/,$line);
my $mismatches;
my $classifier;
my $ms_type = "WT";
my $pre_chr = $fields[0];
my $chr = $chr_convert{$pre_chr};
$start = $fields[3];
$end = $fields[4];
$strand = $fields[6];
$bigstr=$fields[8];
if ($bigstr =~ /\;s\=(.+)\;/) {
$mismatches = $1;
if ($mismatches =~ /[g|r]/mg) { $ms_type = "VAR" } else { $ms_type = "MM" }
}
if ($bigstr =~ /\;u\=(\d.{0,})\n/) { $classifier = $1; }
my @bigstr_fields = split (/\;/,$bigstr);
my $read_id=$bigstr_fields[0];
$read_id=~s/aID\=//;
my $seq=$bigstr_fields[2];
$seq=~s/b\=//;
if ($classifier =~ /^1/) {
print ZERO "$read_id\t$chr\t$start\t$end\t$strand\t$seq\t$classifier\t$ms_type\t$mismatches\n";
} elsif ($classifier eq "0,1") {
print ONE "$read_id\t$chr\t$start\t$end\t$strand\t$seq\t$classifier\t$ms_type\t$mismatches\n";
} else {
print TWO "$read_id\t$chr\t$start\t$end\t$strand\t$seq\t$classifier\t$ms_type\t$mismatches\n";
}
next;
}
close (INFILE);
close (ZERO);
close (ONE);
close (TWO);

[westerman]

Not to be too picky about your code since Perl has "more than one way to do things" but the following lines are incorrect since they will report a incorrect file name in the 'die'.

open (ONE,">$one") or die ("Could not open $zero for writing");
open (TWO,">$two") or die ("Could not open $zero for writing");

Also while I am at it, modern perl practice recommends the 3-argument open. E.g.,

open (ONE, '>', $one) or die ("Cound not open $one for writing");

[rahilsethi]

Total Mapped region of reference?

Hi everyone,

I'm sorry for the deviation from the main question of this thread. Since I was not able to find how to start a new thread, this was the thread that I could find that is related most to my question.

Once mapping is done how will I find the total region of reference mapped? I know that the mapping.stats file gives you Megabases of coverage but that is the sum of length of all reads mapped to reference. So, in case of overlapped mapping the megabases of coverage will be more than the total region of reference mapped. For example:

suppose there are two reads that were mapped to reference as shown below

Read1 AAATTTGCTGC
Read2 GCTGCATTCCA

Reference: AAATTTGCTGCATTCCATTA

The mapping will be:

Read2 GCTGCATTCCA
Read1 AAATTTGCTGC
Reference AAATTTGCTGCATTCCATTA

Here Megabases of coverage will be = 11 x 2 = 22 bases
but total region (length) of reference mapped = 17 bases

Now where will I get total region of reference mapped from the Mapping run of Bioscope?

[drio]

1. You can click in the New post link:



2. I don't think you are going to get that information from the BS output.
You'll have to process the mapped data (BAM or BS text/internal format) to
answer that question.